Entering edit mode
6.5 years ago
Morris_Chair
▴
370
Hello everyone, I’m always “lucky” to catch all the kind of errors in my paths… I run star as I did in the past without many problems, but with this files I have a new issue.. it might be because the reads are too long? Does anybody dealt with this problem before?
STAR --genomeDir genome/Indexed_star/ --runThreadN 4 --readFilesIn /home/RNAseq/fastq_files/file.R1.fq --outFileNamePrefix mapping/star/file.R1. --outSAMattributes All --outSAMtype BAM SortedByCoordinate --quantMode GeneCounts --outFilterMismatchNmax 100
Apr 09 20:17:44 ..... started STAR run
Apr 09 20:17:44 ..... loading genome
Apr 09 20:19:42 ..... started mapping
ReadAlignChunk_processChunks.cpp:171:processChunks EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >
Apr 09 20:19:43 ...... FATAL ERROR, exiting
Segmentation fault (core dumped)
The read start with @ anyways, after trimming I woulnd't expect does N ..
@K00124:54:HTMMCBBXX:1:1101:8968:993 1:N:0:NCGTCC
NGCATCTCAATTTGGAATCCATTAATTCATCAGGTTTTGCCTCTTTCCACACAGCTTCCATATCTGAAGTGTTTGGTGGAGCAAAAATA
+
Thank you for help
what are the outputs of
Hi Pierre, This are:
Merci
and
wc -l file.R1.fq
pleaseHi Pierre, I also counted the number of reads and the number of @ to see if there are reads with no @ and the number is the same
Not true. Unless you had trimmed to remove N's they remain. Some reads at the beginning of the file may have these N's (or are they present in each and every read)?
No they are not present in all the reads but for sure on the first 100 reads or so
thanks
tnx