Question: Probe Sequence Missing from Agilent Data
0
gravatar for vinayjrao
11 months ago by
vinayjrao170
JNCASR, India
vinayjrao170 wrote:

Hi,

I am analyzing raw microarray data obtained using the Agilent system. While looking at the results table, I found that a lot of the probes do not have a probe sequence. Could someone please guide me through these probes? Are these used only by the system, and do not mean anything biologically?

Thank you.

microarray agilent • 284 views
ADD COMMENTlink written 11 months ago by vinayjrao170

Please provide some of these probe IDs. Also, 'probe sequences' do not normally appear in results tables. Can you clarify what you mean by 'probe sequence'?

ADD REPLYlink written 11 months ago by Kevin Blighe59k

Dear Kevin,

Thank you for your response. I am arranging some of the details below -

ProbeUID     ProbeName     Sequence

51568     GT_Mm_44k_51_P314501     ACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCA

1164     (+)E1A_r60_1     Sequence Column is Empty

And you said that probe sequences do not appear in the results table; I shall clarify that I used the script mentioned here previously enter link description here, and modified it according to my need.

ADD REPLYlink written 11 months ago by vinayjrao170
1

E1A_r60_1 is an Agilent positive control probe. You should remove this and the other control probes from your dataset after you have normalised the data.

ADD REPLYlink modified 11 months ago • written 11 months ago by Kevin Blighe59k

Thanks Kevin, for the clarification. Although, I would like to know why I should remove these after normalization, and what is the significance of these positive control probes?

ADD REPLYlink written 11 months ago by vinayjrao170
1

The positive control probes are used during normalisation. In any experiment, the level of binding of these probes is expected to be consistent in each sample. They are akin to, for example, targeting GAPDH in PCR experiments.

You will find a lot more material online about both these and negative controls.

Why would you need these in your dataset when you proceed to differential expression analysis?

ADD REPLYlink written 11 months ago by Kevin Blighe59k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1845 users visited in the last hour