Question: Why Ks value is NA in KaKs calculator
0
gravatar for Laura_zz
17 months ago by
Laura_zz0
Laura_zz0 wrote:

My sequence is :

>AAA
ATGGTGGGGCAGACCATGATGCGCATCGTGCGGCCCTGCTTCAAGCCCTCGCTGCCCGACGGCGCGCAGGTCGTCGCCGCCGGGGGCGGCGGCACCAGGGAGGGCCTGCTCTGGTACAGGGACGCCGGCCGCCACGCCTGCGGCGACTTCTCCATGGCCGTCGTGCAGGCCAACCAGCTGCTCGAGGACGCCAGCCAGCTCGAGGCCGGGCCCCTCGTCGCCGCCGACGGGCCCTGCGCCACCTTCGTCGGCGTCTACGACGGCCACGGCGGGCCCGAGACCGCCCGCTTCGTCGCCGATAACCTCTTCCACCACCTCAAGAAGTTTGCGACGGAACAACAGACAGTCTCGGCCGACGTGATACGCCGATCCTACGCTGCCACGGAGGAGGGCTTTCTGAACCTTGTGAGGAAGCAGTGGCTCATCAAGCCGCAGATCGCCTCGGTCGGTACATGTTGTTTGGTTGGCATTATCAACGAAGGTGTTCTGTACATAGCAAACGCCGGCGACTCCCGTGCTGTCCTCGGGAGAGTCGAGCGGGGCGCCAAAGACATTAAGGCAGTTCAGCTCTCGTCCGAGCATAACGCGAGCTTTCAGGAGGTAAGGGATGAGCTAAGACAGATGCACCCGGACGACCCCCGGATCGTGGTCCTCAAGCACAATGTTTGGCGCGTCAAGGGCATTATTCAGGTTTCCAGAACGATCGGTGACGCCTACCTAAAAAGTTCGGAGTTTAACCGCGAGCCTCTTCTGGCCCGGTTCCGTATTCCAGGGCCCTTCCATAAACCGATTCTTTGTCCGGAACCATCCATAGAAGAACACAGACTGTGCGCAGAAGATCAGTTTGTTATATTTGCGTCAGATGGACTATGGGAGCACTTGAGCAATCAGGAAGCTGTGGATATAGTTCATTGTTCGCCTCGGAATGGCATTGCGAGACGACTAATAAAAGCAGCTCTGCGGGAGGCGGCAAAGAAGAGAGAAATGAGATACTCAGACTTGAAGAAGATCGACCGCGGGGTCAGGAGGCACTTCCACGATGATATTACTGTTGTGGTATTATTCATGGACCCTGCGCTTGTCAGCAGGAGGCTCTACGGTGGGCCGTTGCTTTCGCTAAGGGGTGGTGGCAGCACGCCAACGTTTGCACAGAAATGC
ATGAATGACACTAATCCCTCGGTTCCATCTTTCAGGAGGCAGATTCTGCTCGGTCTCTCTTGGTTTAGGCCAACGCAGATGGTTGATCCTGACGATCTTCGGAGGGCGATCGGTCTTCCTGTTACTGCTTCGCTGGGCCCTGTTGGTCCCCTCCTCCGGCAACTCCATGAGGGGGTCAGTGAGGATGAGATTCAGAGGCTCACGGTGCATTTCGATGGATTATGCGTCTCCCTCATGCATCAGTCAGAGGTGGAGAAACCTAGCTTCGCCGCCAAGTGCTGGATGAGTGAGGTCCGGGAACTTTGCTACGACAGCAAAAACTACTTCGACGATGCCCCGTTTATTTCCAAGCAAGACGACGACGATGATGATGCCCAGCTCACTCCAGAAGAGAAGCAAGAAAATGCCCAGTTCGAGTTCAAGATGATCGAGGCTCGCGCGGAGCATGCGTATGGGAGAAGGGGAAGGTACGGATTCGACCAGAAAAGCGTCAATAAGACCACTAAGATTCCATCAACAGGACGCCGGCTCCCAGTTCTCCATCCGGAACTAATTGATCGTTGCCGAATGGATCAACTTGACACCTTGCTTCGTAAGGATGAGGAGCAGCAGCTCAAGGTCGTATCTCTGGTAGGATTTGAGGGTGTCGGTAAAACCACACTTGCCAAGAGGTTATACCACCATAGAGGTGGGCAGTTCAACTGCCGGGCTTTTGTGCGGGTGTCTCCCAACCCGGACATGAGGAGGCTTCTAACCACCATATTCACCCAGATTCAATTGCCGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTGGTACTGTCTCTCAGCCTGCTTGCTGCTTGGATGCGCAGGCCCTCATCATAAATATTGCAAAATATCTCCAATCAAGAAGGTACTTAATCATAATTGATGACTTATGGAGTACTTCAGCATGGGATGTTATTAGGCGTGCTTTTCCTGATGGTGATTGTCACAGCAGAATTATAACAACCACCCAATTCGGGGATGTAGCATCGGCATGTTGTAGTTATCAGTCAAAGTACGTATTTCATATGGAACCTCTAAAATATGATCAATCACGAAAATTGTTTTTCAGTATAGTGTTTGGCTCTGAAGATAAAGTCAGTTTTCCTGAGGATTTCAGAGAAGTCTCATCTGAGATTGTCAAGAAATGTGGTGGTTTACCATTATCAATTATAAATATAGCCAGCTTGTTGCCAACAGAAGAAAGCGAAATAAACCTCCAGCAATGGATGGACATTCGAGATTATATGCCTTCCACTATGAGGACAAATCCTACGCCCGAAGGGATAAAACAAGTTCTAAACCTTGTCTACAATAATCTTTCCCCTGAACTGAAGACATGCTTGCTGTATCTTGTTGTGAATCCAGAGGGCTACATGGTGAGTAAGGATGATTTGGTGAAGCAATGGGTAATTGAAGGTTTTATACGGGAAGGACAAAACAAAGAGGAAATTGCAGGGGGTTATTTTGATGAGCTTGTCAGGAGAGGCATGATCCAGGCTGTAGACATCAATTACCGAGGGGTGCTGTCATGTACACTTCACCACATGGTACATGATCTTATTGTGAAGAAATCCATTGAGGAAAATTTCATAGTTATCCAGGACTGTTTTCAATCAGCTATAGGTCTTCCTGACAAAGTTCGTCGTCTGTCTGTCCAATTCGGTGGTGCAAGGAGCGCAAATATACCGATGGGAGTCATGATGTCTGAAGTTCGATCACTTGCATTTTTTGGATTCTATGGATGCACGGACTTCATTGAGGAGTGTAAGCTTCTTCGAGTTCTAATTCTCCATGTGTGGGCTGATGAAGATAAAGTGCCTTTTGACCTCTCTGAAATTATTAGTAAACTACTTCCATTGAGATATGTGAAGATTGCATGTAATATCGCTGTCAAACTTCCAGCCGAGATTCAAGTTCTGCAATTCCTGGAGATACTGGAAGTGGATACACCAGTAGTTGCTATCCCATCGGATATTGGAGGACTCAGCAGGCTGTCCAGTCTAAAGATTGCAGTTACAGAGCTATTGAGGGAAGACATTTGTATCCTCCAAAAATTGGCAGCCCTCACTACTCTTTCAGTGGACGTGAAGACATCACCCACTGAATGGATCGTCTTTGGAAAGGGAGGATTCTTGGTCCTCACTTTCTTCACATTCAGGTGCAGTGCACCTCGTCTGCTAATTGAAGATAGTGCAATACCTAAATGCGAGAAGCTACACCTATGTTTAAATGGCCACGAAGCATCTCCTCGAGATGGTAAGAAGCCTATCACCATCGAGCACTTGGCAAGCCTTAAAGAGATATCTGTAAAAATTTGGGGTGCAGTTGCTAACAAGGGGTCCGCCTTGACGAATGTTATTACCAATGATGCAAGAAATCCTATTCCTAACGTTCAATTGATGGGTGATACCAGTGGTGTAGAAGTCCACATGATCTTCGACCTCAACGATGGTGATTATGCTGAATTCATCCGCCTCCTTATTGGCGTGCTCGTGAGGTACGACGACGGTGAACACATCCAAGGGTATCCTCCTGTTCTGGGTAAGCAACTGTTCCCGAAAGAGCCAAACAGGTGGATGCGCATCAAGCTAGTGGCCGGCATGACTGAAACAATCCTTGCTGTTCGGGATGACAATCTGAACCTCATTGGCTTCCAGGCTAAAAACGGAAGGTGGTACGAGTTGGGGTTCGCAGGGAGGAGCACACGAATGCTTCCTGGATCCACCTTTTTAGACTGCGATTGTGACTATACAGACTTGCTACAGGTAAAAGCTACCTGTCTGGAAGAAAGAAACCGACTAGTCAGGGAAGAAATGGTGAAGATAGAGCTAGGCAAGACCTCCTCAATTGAAGCCGTGGGTATTCTCTCGGGCTACAATAATAAAACGGAAGGTGTGGCAGCTGATCGAGACACCAGGCGGGCACTGGTGCGCCTAATGCTCATGTTGTGCGAGGCCACGAGGATGACCCCATTCTTTGACACCGTGCTGGCTAGCTGGAGCGACACACAAGGAGGGAATAGCCATATCTTGAGAGAGGACCAGGCAATGTACGTTTGGTACTGGGGAAAAATGTCGGCCGTGCTGCTGGAGTGGGAGGCAACAGGTTATAAGAGTTGGGGACCAAATGAGACCACCGCGATGCTGGCCAATGAAATCAATGTCAAATCTGCACAAGAGGCACTCGCTGTCGTCAAGGTGCTTCTCAACACACCCGTCGCCCCCAACAACACTTGCACCAGAGGAGGCCGACCTCTTGTGGAGGTGTTTACCATGCGTGCTGACTCCGGTGTTGTTGACACCATTTCGGTTTTTGACGGGAGACGTGGCCAGACCATATACAGACACCATGCTAGCCCCACTCCTATCCACCACTTTTGGTCTTCGTCTCAAGGTCCTAACGATTTGGTACTCACTGGACCATATAGAGCCATCTCAGCGGAGGGCAGCTTCGCCATCCAAGTCGACAGCATCATCTCCAGGACAGACGCCTCTGACGAACCTAGTAAAGTCAGTGCTGACATGTCCTGGGATTGCTACTCCGGTGAAGCCTCCATGTACAACAAGGTCTTGACCAACCGCATCGCCACAGACGACAAAGGCCAACTTGCAGAAGTGGCCTATGCTGTGTTCAGTGACGCCGTGGAGGTCACCGTCCAAATAAAGGTGACTAGAGTTGACCCCGCCGACGTTTACGGTAAAATCACCGCGCACAACCAGCACTACGGCAGCAACAGCATACTGCTCTTCAGCCGTACAGATTGGGATTTCCTTGCAACAAAGGAGGAAAAGAGGCAAGGAAGAAGGCGTGCAAAACTGAGGGCAAGTGGAACTTCCAATTGCTGGATTCCACTTACGCGATCCGTCGTTGCGGTGCCATTAGGCTCGCCGCTTGAGATAAGGGTCAATTTGTATGCATGTCCATCCGAATATGGGCTTACTGATTATTTCAAGGAGGATATAGATTTTTCTCTCATAGATCAGCATGTGGGGCAAATCAAAAGGCACCATGTGGTGGTTCGAGTGACCTCGCTGGACATCTGCACTCTCCCGGAACAAAGTCACACAACACTGCCTACGCTCGCCATGACCTGGGTTCCAGGGGTGACAAGTATGAGGACGGGGGCAGGAATGCCCATCGAGCAGCCTGCACATGTGTATATGGACTTCAACTGTGGCAGTGGTAAGTACAGTGCATTCATGGACGACTTGTGTGAAAAGCTTGCGGAGCACCCGGGCAAAGCTGCTGTCCATGGGCGGCCTGTCCTCGCCAGGCAGCGGCGTGGAAAGCCAACGAGGCTGTTTATGATCAGGCTAGCGGGTGACAGAGATTATGAATGGGTAACTCTGGCCGTTCGGGACGACAACTTGTGCCTCGTTGGCTTCCAAACTCCGGACGGGAGGTGGCACGAGTTCGGCTCCGGCTCCATAACTTGTCTCCAAGAGTCCACCTTTTTAGGGTCCAATGGAAGCTATGATAGCTTATTAGGTGAATCTGGAGACCGGTGGCAAGAGCTGAAGCTGGGCAGGAAGTCCGCAACAGATGCCATAGGAAAGCTCTCGGCGTACGAGGACCGAGTGGGCGTAGTAGTTGATCAAGACACCAAAGTGGATTTGGCTCGCCTGATGGTCATGATATGCGAGGCCGCACGGTTGGCAGAAATCTACGACATGGTGAAGAAAGGATGGGAAGACGGAATCTGTATCACCGACCGGCAGGTACAGCACATAGATAACTGGGACAATATTTCTCGCGTTCTGCTTGGCAGAAGAAGGAGAGTCAGAAACATAGGTTTGAAGAAGGAAGACGACGCGGCAGCTGTAGTGAAGATGGTGCTTAACCCTTTCCGTCCCCTTGTGGAGGTGTTTGGCCTGCGTGCTTACCCTAGTTTCAGTGGCACCATCTCCGCCGTGGACGACAAAGGAAGCAAGGTCGTCATTTACAACAAGGACCCTCAAGCCAAACGAGATGATACTCCGTCCTCTCAGACGCAAACTCAGAGTAATATCGATTGTCACCACAAAGAAGCACAGGAGGATTTGCCACCTGCTGTAACGTACAGACCCATCTCAGCTGACGGGGAGTTCTACATTCAAGTCAGTGGCAATTCCACCACACATACCTCCCGTCTCACCTTGGTATGGGATGGTCATTCCGATAAAGCTGCGTACAACATCATCAACACACACCAAATCAGCATAGGCAGCTCCAAAGCTGAACTAACGTATGCGGTGCTCCACGATGCCGTGGAGGCCACCGTGAAGGTCCAGCTGAATCTCAAGGAACCCGAAGAAGCTGGCACCGTCACCGGCGTGTACGGTGAAATCACCGCGACCAACCAGCACTACAAGAACAAGAGCATCCTGCTCTTCAGCCATCCAAAGGAACAGGCAGTAAAACCCGAGGTCAATGCCTCGGATGCCGTTTCAATTTCACTCAAGTTGATGAGGGGTTTCATTGTGGCGTCACTTGAGCGCTTGCTTGTGATAAAGGTTAGCTTGCGTGCTGTGTGCTCCAGCTATGAGGAACCCATATGCTTCGAGCAAGAAGTGAGTTTCGACCCCAATATGGGTACCGCGCAAACAGCGAAGATCGATGCACCCACTATGGAGGCTCAAGTGATGTTCATCACCAACGAGCGAAATGCGCCCAGCCAGGGAAGGGTAAAGCAATGGCGCCGGCGACCACGCGCGAGTGCCGCAATACTCCCCAACACTACTACTGCGGGA

In the KaKs calculator, I use the NG method and get the NA of the ks value. I don't know what problems they have. What should I do?

kaks gene software error • 440 views
ADD COMMENTlink modified 16 months ago by Biostar ♦♦ 20 • written 17 months ago by Laura_zz0
2

at first sight there are a few things going on here:

  • for KaKs analysis you need two sequences (can we assume the ones you posted are actually two sequences)
  • the sequence needs to be correctly aligned, for Ks analysis that should even be codon-aware alignment
  • normally you would expect the sequences to be of comparable length (Ks analysis only makes sense between homologous sequences)

Can you check these points first?

ADD REPLYlink modified 17 months ago • written 17 months ago by lieven.sterck9.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1050 users visited in the last hour