Why Ks value is NA in KaKs calculator
1
0
Entering edit mode
2.8 years ago
Laura_zz • 0

My sequence is :

>AAA
ATGGTGGGGCAGACCATGATGCGCATCGTGCGGCCCTGCTTCAAGCCCTCGCTGCCCGACGGCGCGCAGGTCGTCGCCGCCGGGGGCGGCGGCACCAGGGAGGGCCTGCTCTGGTACAGGGACGCCGGCCGCCACGCCTGCGGCGACTTCTCCATGGCCGTCGTGCAGGCCAACCAGCTGCTCGAGGACGCCAGCCAGCTCGAGGCCGGGCCCCTCGTCGCCGCCGACGGGCCCTGCGCCACCTTCGTCGGCGTCTACGACGGCCACGGCGGGCCCGAGACCGCCCGCTTCGTCGCCGATAACCTCTTCCACCACCTCAAGAAGTTTGCGACGGAACAACAGACAGTCTCGGCCGACGTGATACGCCGATCCTACGCTGCCACGGAGGAGGGCTTTCTGAACCTTGTGAGGAAGCAGTGGCTCATCAAGCCGCAGATCGCCTCGGTCGGTACATGTTGTTTGGTTGGCATTATCAACGAAGGTGTTCTGTACATAGCAAACGCCGGCGACTCCCGTGCTGTCCTCGGGAGAGTCGAGCGGGGCGCCAAAGACATTAAGGCAGTTCAGCTCTCGTCCGAGCATAACGCGAGCTTTCAGGAGGTAAGGGATGAGCTAAGACAGATGCACCCGGACGACCCCCGGATCGTGGTCCTCAAGCACAATGTTTGGCGCGTCAAGGGCATTATTCAGGTTTCCAGAACGATCGGTGACGCCTACCTAAAAAGTTCGGAGTTTAACCGCGAGCCTCTTCTGGCCCGGTTCCGTATTCCAGGGCCCTTCCATAAACCGATTCTTTGTCCGGAACCATCCATAGAAGAACACAGACTGTGCGCAGAAGATCAGTTTGTTATATTTGCGTCAGATGGACTATGGGAGCACTTGAGCAATCAGGAAGCTGTGGATATAGTTCATTGTTCGCCTCGGAATGGCATTGCGAGACGACTAATAAAAGCAGCTCTGCGGGAGGCGGCAAAGAAGAGAGAAATGAGATACTCAGACTTGAAGAAGATCGACCGCGGGGTCAGGAGGCACTTCCACGATGATATTACTGTTGTGGTATTATTCATGGACCCTGCGCTTGTCAGCAGGAGGCTCTACGGTGGGCCGTTGCTTTCGCTAAGGGGTGGTGGCAGCACGCCAACGTTTGCACAGAAATGC
ATGAATGACACTAATCCCTCGGTTCCATCTTTCAGGAGGCAGATTCTGCTCGGTCTCTCTTGGTTTAGGCCAACGCAGATGGTTGATCCTGACGATCTTCGGAGGGCGATCGGTCTTCCTGTTACTGCTTCGCTGGGCCCTGTTGGTCCCCTCCTCCGGCAACTCCATGAGGGGGTCAGTGAGGATGAGATTCAGAGGCTCACGGTGCATTTCGATGGATTATGCGTCTCCCTCATGCATCAGTCAGAGGTGGAGAAACCTAGCTTCGCCGCCAAGTGCTGGATGAGTGAGGTCCGGGAACTTTGCTACGACAGCAAAAACTACTTCGACGATGCCCCGTTTATTTCCAAGCAAGACGACGACGATGATGATGCCCAGCTCACTCCAGAAGAGAAGCAAGAAAATGCCCAGTTCGAGTTCAAGATGATCGAGGCTCGCGCGGAGCATGCGTATGGGAGAAGGGGAAGGTACGGATTCGACCAGAAAAGCGTCAATAAGACCACTAAGATTCCATCAACAGGACGCCGGCTCCCAGTTCTCCATCCGGAACTAATTGATCGTTGCCGAATGGATCAACTTGACACCTTGCTTCGTAAGGATGAGGAGCAGCAGCTCAAGGTCGTATCTCTGGTAGGATTTGAGGGTGTCGGTAAAACCACACTTGCCAAGAGGTTATACCACCATAGAGGTGGGCAGTTCAACTGCCGGGCTTTTGTGCGGGTGTCTCCCAACCCGGACATGAGGAGGCTTCTAACCACCATATTCACCCAGATTCAATTGCCGACCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTGGTACTGTCTCTCAGCCTGCTTGCTGCTTGGATGCGCAGGCCCTCATCATAAATATTGCAAAATATCTCCAATCAAGAAGGTACTTAATCATAATTGATGACTTATGGAGTACTTCAGCATGGGATGTTATTAGGCGTGCTTTTCCTGATGGTGATTGTCACAGCAGAATTATAACAACCACCCAATTCGGGGATGTAGCATCGGCATGTTGTAGTTATCAGTCAAAGTACGTATTTCATATGGAACCTCTAAAATATGATCAATCACGAAAATTGTTTTTCAGTATAGTGTTTGGCTCTGAAGATAAAGTCAGTTTTCCTGAGGATTTCAGAGAAGTCTCATCTGAGATTGTCAAGAAATGTGGTGGTTTACCATTATCAATTATAAATATAGCCAGCTTGTTGCCAACAGAAGAAAGCGAAATAAACCTCCAGCAATGGATGGACATTCGAGATTATATGCCTTCCACTATGAGGACAAATCCTACGCCCGAAGGGATAAAACAAGTTCTAAACCTTGTCTACAATAATCTTTCCCCTGAACTGAAGACATGCTTGCTGTATCTTGTTGTGAATCCAGAGGGCTACATGGTGAGTAAGGATGATTTGGTGAAGCAATGGGTAATTGAAGGTTTTATACGGGAAGGACAAAACAAAGAGGAAATTGCAGGGGGTTATTTTGATGAGCTTGTCAGGAGAGGCATGATCCAGGCTGTAGACATCAATTACCGAGGGGTGCTGTCATGTACACTTCACCACATGGTACATGATCTTATTGTGAAGAAATCCATTGAGGAAAATTTCATAGTTATCCAGGACTGTTTTCAATCAGCTATAGGTCTTCCTGACAAAGTTCGTCGTCTGTCTGTCCAATTCGGTGGTGCAAGGAGCGCAAATATACCGATGGGAGTCATGATGTCTGAAGTTCGATCACTTGCATTTTTTGGATTCTATGGATGCACGGACTTCATTGAGGAGTGTAAGCTTCTTCGAGTTCTAATTCTCCATGTGTGGGCTGATGAAGATAAAGTGCCTTTTGACCTCTCTGAAATTATTAGTAAACTACTTCCATTGAGATATGTGAAGATTGCATGTAATATCGCTGTCAAACTTCCAGCCGAGATTCAAGTTCTGCAATTCCTGGAGATACTGGAAGTGGATACACCAGTAGTTGCTATCCCATCGGATATTGGAGGACTCAGCAGGCTGTCCAGTCTAAAGATTGCAGTTACAGAGCTATTGAGGGAAGACATTTGTATCCTCCAAAAATTGGCAGCCCTCACTACTCTTTCAGTGGACGTGAAGACATCACCCACTGAATGGATCGTCTTTGGAAAGGGAGGATTCTTGGTCCTCACTTTCTTCACATTCAGGTGCAGTGCACCTCGTCTGCTAATTGAAGATAGTGCAATACCTAAATGCGAGAAGCTACACCTATGTTTAAATGGCCACGAAGCATCTCCTCGAGATGGTAAGAAGCCTATCACCATCGAGCACTTGGCAAGCCTTAAAGAGATATCTGTAAAAATTTGGGGTGCAGTTGCTAACAAGGGGTCCGCCTTGACGAATGTTATTACCAATGATGCAAGAAATCCTATTCCTAACGTTCAATTGATGGGTGATACCAGTGGTGTAGAAGTCCACATGATCTTCGACCTCAACGATGGTGATTATGCTGAATTCATCCGCCTCCTTATTGGCGTGCTCGTGAGGTACGACGACGGTGAACACATCCAAGGGTATCCTCCTGTTCTGGGTAAGCAACTGTTCCCGAAAGAGCCAAACAGGTGGATGCGCATCAAGCTAGTGGCCGGCATGACTGAAACAATCCTTGCTGTTCGGGATGACAATCTGAACCTCATTGGCTTCCAGGCTAAAAACGGAAGGTGGTACGAGTTGGGGTTCGCAGGGAGGAGCACACGAATGCTTCCTGGATCCACCTTTTTAGACTGCGATTGTGACTATACAGACTTGCTACAGGTAAAAGCTACCTGTCTGGAAGAAAGAAACCGACTAGTCAGGGAAGAAATGGTGAAGATAGAGCTAGGCAAGACCTCCTCAATTGAAGCCGTGGGTATTCTCTCGGGCTACAATAATAAAACGGAAGGTGTGGCAGCTGATCGAGACACCAGGCGGGCACTGGTGCGCCTAATGCTCATGTTGTGCGAGGCCACGAGGATGACCCCATTCTTTGACACCGTGCTGGCTAGCTGGAGCGACACACAAGGAGGGAATAGCCATATCTTGAGAGAGGACCAGGCAATGTACGTTTGGTACTGGGGAAAAATGTCGGCCGTGCTGCTGGAGTGGGAGGCAACAGGTTATAAGAGTTGGGGACCAAATGAGACCACCGCGATGCTGGCCAATGAAATCAATGTCAAATCTGCACAAGAGGCACTCGCTGTCGTCAAGGTGCTTCTCAACACACCCGTCGCCCCCAACAACACTTGCACCAGAGGAGGCCGACCTCTTGTGGAGGTGTTTACCATGCGTGCTGACTCCGGTGTTGTTGACACCATTTCGGTTTTTGACGGGAGACGTGGCCAGACCATATACAGACACCATGCTAGCCCCACTCCTATCCACCACTTTTGGTCTTCGTCTCAAGGTCCTAACGATTTGGTACTCACTGGACCATATAGAGCCATCTCAGCGGAGGGCAGCTTCGCCATCCAAGTCGACAGCATCATCTCCAGGACAGACGCCTCTGACGAACCTAGTAAAGTCAGTGCTGACATGTCCTGGGATTGCTACTCCGGTGAAGCCTCCATGTACAACAAGGTCTTGACCAACCGCATCGCCACAGACGACAAAGGCCAACTTGCAGAAGTGGCCTATGCTGTGTTCAGTGACGCCGTGGAGGTCACCGTCCAAATAAAGGTGACTAGAGTTGACCCCGCCGACGTTTACGGTAAAATCACCGCGCACAACCAGCACTACGGCAGCAACAGCATACTGCTCTTCAGCCGTACAGATTGGGATTTCCTTGCAACAAAGGAGGAAAAGAGGCAAGGAAGAAGGCGTGCAAAACTGAGGGCAAGTGGAACTTCCAATTGCTGGATTCCACTTACGCGATCCGTCGTTGCGGTGCCATTAGGCTCGCCGCTTGAGATAAGGGTCAATTTGTATGCATGTCCATCCGAATATGGGCTTACTGATTATTTCAAGGAGGATATAGATTTTTCTCTCATAGATCAGCATGTGGGGCAAATCAAAAGGCACCATGTGGTGGTTCGAGTGACCTCGCTGGACATCTGCACTCTCCCGGAACAAAGTCACACAACACTGCCTACGCTCGCCATGACCTGGGTTCCAGGGGTGACAAGTATGAGGACGGGGGCAGGAATGCCCATCGAGCAGCCTGCACATGTGTATATGGACTTCAACTGTGGCAGTGGTAAGTACAGTGCATTCATGGACGACTTGTGTGAAAAGCTTGCGGAGCACCCGGGCAAAGCTGCTGTCCATGGGCGGCCTGTCCTCGCCAGGCAGCGGCGTGGAAAGCCAACGAGGCTGTTTATGATCAGGCTAGCGGGTGACAGAGATTATGAATGGGTAACTCTGGCCGTTCGGGACGACAACTTGTGCCTCGTTGGCTTCCAAACTCCGGACGGGAGGTGGCACGAGTTCGGCTCCGGCTCCATAACTTGTCTCCAAGAGTCCACCTTTTTAGGGTCCAATGGAAGCTATGATAGCTTATTAGGTGAATCTGGAGACCGGTGGCAAGAGCTGAAGCTGGGCAGGAAGTCCGCAACAGATGCCATAGGAAAGCTCTCGGCGTACGAGGACCGAGTGGGCGTAGTAGTTGATCAAGACACCAAAGTGGATTTGGCTCGCCTGATGGTCATGATATGCGAGGCCGCACGGTTGGCAGAAATCTACGACATGGTGAAGAAAGGATGGGAAGACGGAATCTGTATCACCGACCGGCAGGTACAGCACATAGATAACTGGGACAATATTTCTCGCGTTCTGCTTGGCAGAAGAAGGAGAGTCAGAAACATAGGTTTGAAGAAGGAAGACGACGCGGCAGCTGTAGTGAAGATGGTGCTTAACCCTTTCCGTCCCCTTGTGGAGGTGTTTGGCCTGCGTGCTTACCCTAGTTTCAGTGGCACCATCTCCGCCGTGGACGACAAAGGAAGCAAGGTCGTCATTTACAACAAGGACCCTCAAGCCAAACGAGATGATACTCCGTCCTCTCAGACGCAAACTCAGAGTAATATCGATTGTCACCACAAAGAAGCACAGGAGGATTTGCCACCTGCTGTAACGTACAGACCCATCTCAGCTGACGGGGAGTTCTACATTCAAGTCAGTGGCAATTCCACCACACATACCTCCCGTCTCACCTTGGTATGGGATGGTCATTCCGATAAAGCTGCGTACAACATCATCAACACACACCAAATCAGCATAGGCAGCTCCAAAGCTGAACTAACGTATGCGGTGCTCCACGATGCCGTGGAGGCCACCGTGAAGGTCCAGCTGAATCTCAAGGAACCCGAAGAAGCTGGCACCGTCACCGGCGTGTACGGTGAAATCACCGCGACCAACCAGCACTACAAGAACAAGAGCATCCTGCTCTTCAGCCATCCAAAGGAACAGGCAGTAAAACCCGAGGTCAATGCCTCGGATGCCGTTTCAATTTCACTCAAGTTGATGAGGGGTTTCATTGTGGCGTCACTTGAGCGCTTGCTTGTGATAAAGGTTAGCTTGCGTGCTGTGTGCTCCAGCTATGAGGAACCCATATGCTTCGAGCAAGAAGTGAGTTTCGACCCCAATATGGGTACCGCGCAAACAGCGAAGATCGATGCACCCACTATGGAGGCTCAAGTGATGTTCATCACCAACGAGCGAAATGCGCCCAGCCAGGGAAGGGTAAAGCAATGGCGCCGGCGACCACGCGCGAGTGCCGCAATACTCCCCAACACTACTACTGCGGGA

In the KaKs calculator, I use the NG method and get the NA of the ks value. I don't know what problems they have. What should I do?

KaKs software error gene • 1.0k views
ADD COMMENT
2
Entering edit mode

at first sight there are a few things going on here:

  • for KaKs analysis you need two sequences (can we assume the ones you posted are actually two sequences)
  • the sequence needs to be correctly aligned, for Ks analysis that should even be codon-aware alignment
  • normally you would expect the sequences to be of comparable length (Ks analysis only makes sense between homologous sequences)

Can you check these points first?

ADD REPLY
0
Entering edit mode
8 months ago
fznajar • 0

If the nucleotide and amino acid sequence are correctly aligned, this could be due to a SNP that results in the generation of a stop codon. Hence you are getting a truncated protein.

ADD COMMENT

Login before adding your answer.

Traffic: 2176 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6