Question: Error while importing data into Qiime2
0
gravatar for jeccy.J
9 days ago by
jeccy.J50
Argentina
jeccy.J50 wrote:

Hi everyone,

I am trying to import fastq files (16s amplicon sequence data) into qiime2 pipeline but some error occurred. Can anyone please help me out to solve the error.

$ qiime tools import --type SampleData[PairedEndSequencesWithQuality] --input-path primer_trimmed_fastqs --output-path reads_qza/reads_trimmed.qza  --input-format CasavaOneEightSingleLanePerSampleDirFmt

Error: There was a problem importing primer_trimmed_fastqs: Missing one or more files for CasavaOneEightSingleLanePerSampleDirFmt: '.+_.+_L[0-9][0-9][0-9]_R[12]_001\.fastq\.gz'

Thanks advance.

JC

sequence • 110 views
ADD COMMENTlink modified 9 days ago by swbarnes26.0k • written 9 days ago by jeccy.J50
1
gravatar for swbarnes2
9 days ago by
swbarnes26.0k
United States
swbarnes26.0k wrote:

Okay, so it looks like your fastq names don't match the regex that the import function expects. but if you choose not to tell us what your file names are, we can't possibly help you there.

ADD COMMENTlink written 9 days ago by swbarnes26.0k

The file name are as below :

Fan1_S26_L001_R1_001.fastq Fan7_S34_L001_R1_001.fastq Fan1_S26_L001_R2_001.fastq Fan7_S34_L001_R2_001.fastq Fan4_S31_L001_R1_001.fastq Fan9_S36_L001_R1_001.fastq Fan4_S31_L001_R2_001.fastq Fan9_S36_L001_R2_001.fastq

head of one file

@M02975:138:000000000-CFCFY:1:1101:20173:2157 1:N:0:26
ATTGGTCAATGGGCGAGAGCCTGAACCATCCAAGTCGCTTTACTTACGCCGGTTCTATGGTTTGTAAACTTCTTTTGTAGATGATTAATTGCAGCTACGTGTAGCTGAGTTTCATGTACTCTACTAATAAGTATCGTCTAACTCCTTTCCATCAGCCGCGGTAATACGCAGGATACTATCGTTATCCGGTATTATTTTTTTTAATGGGTGCGTAGGTGTCGTATTAAGTCAGTGGTGAAAATCTGCAGCTCAACTGTATTCTTGCCGTTGTAACTGATTTTT
+
GGGGGGGGCF<EFFC7:++CCE,,,,C,,;6,,,;,,+,:,,,,,,9,,7++8@@C,C,,,:C,C,,,9CE<EEEE,B,5,,,,,:,,<,,9,,5B,5+B<F,,@?,,,,:,:,:,C,AB<A,5,,,9,,,:,>A+,8A+,7>,6,9,76,,3,,3A+6++6++5,76+++++6,6,,,7*@@*53,****45,5=,+,4?=**+1+*2**)985);98;3:*;A++33)+7<7)7,).***0:562)/)),.(5(6.47-99**.)9:0(.)-6)).)1))
@M02975:138:000000000-CFCFY:1:1101:15367:2171 1:N:0:26
ATTGGTCAATGGGCGTAAGCCTGAACCAGCCAAGTAGCTTTCAGGATGACGGCCCTATGGTTTTTTAACTGCTTTTACAGGGGCATAAATTTCGACACGTTTGTTTCATTTCTTTTACCCTTCGCATATGGACCGGCTAATTCCTTTCCAGCATCCGCGGTAATACGGATGGTCCTGTTTTTATCCGGTTTTATTGTGTTTAATTGGAGCGTAGGCCGCTGCTTAAGTGTGTTGTTAAATTCATGCGCCCAACGTCTTGCTTCCAGCTCCAACTTGTCTTCT
+
GGGGGGGGGGEECFCFCC@EFG8<,CF,,CD,,,;,,;,<,;,,,,:,,9,+677C,C,,,:C,D+,,<C,6CEEF,:,,,,+++9,,,,<,<,+8+7+B,A+AFBE,CE,B,:,9,59,C,A+++6+,8,,76++8>+,8@;>,8,@C,,,,,8=+84+@**7,3****3*556>,,5,>:,>;2***2:?,=C,,+4AF,++++***0/:*))*;))(.)2:+++;*6*.40<0)).1:0**.),.00)(4(418()06@))*)/*.((((.)).--*64
@M02975:138:000000000-CFCFY:1:1101:10964:2172 1:N:0:26
CTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTTAGTTCATAATGTTTTCGGATCGTATAGCTCTTTTGTTAGAGAATAACGTGTGTGAGAGTGGAAATTTCACACTGTGACGGTATCTTACCAGACAGCTACTGCTAACTACGTGCCAGCAGCCGCGGTAATACGTATGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCATGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGTTAACTGTT
ADD REPLYlink modified 9 days ago • written 9 days ago by jeccy.J50

qiime2 is clearly looking for reads file that end in .gz. So why don't you zip yours (how did they get unzipped in the first place?) and try again?

ADD REPLYlink written 9 days ago by swbarnes26.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2035 users visited in the last hour