You can use samtools tview in order to visualize aligned reads spanning a specific position in you sorted bam.
samtools tview [-p chr:pos] [-s STR] [-d display] <in.sorted.bam> [ref.fasta]
If -d is set to T you can visualize output as text alignment file. As example:
47696431 47696441 47696451 47696461 47696471 47696481 47696491
AATCCCCAGTCTTTGCCTTGCACAAACCTATATGCCCGTTGACTCTCTGGGGTGGGGAAAAAAAAAGTCATATTTAAGGT
................................................................................
,,,,,,,,,,,,,,,,, ,,,,,,,,,,,,,,,,,,,,,,,, ,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
................................................................................
................................................................................
...................................A............................................
...................................A............................................
................................................................................
................................................................................
................................................................................
................................................................................
...................................A............................................
...................................A............................................
................................................................................
................................................................................
................................................................................
Take a look at this for further information.
Hello Pierre-- very useful application. thank you. Is there a way to control aesthetics of the svg? ie sample name, coordinates, grey banding in background? Thanks!