Question: (Metagenome) Kraken2 : What is "x" replacing the genome sequence?
0
gravatar for m.u
4 weeks ago by
m.u0
m.u0 wrote:

Hello, I'm using the standard Kraken 2 database.

What is meant by "x" character replacing the eukaryotic genome sequence in library.fna that is reference genome?

What is different from N?

CCCAAACGACTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxACCCCGCACCAAAAAACATCCNNNNNNNNNNNGGCATGTCCGG
AGACTCCAGTTCTTGGAAAGGATGGGGTCATGTCAGGTGGTTCATCGAGGAGGTACCCGC
CGGAGCTGCGTGAGCGGGCGGTGCGGATGGTCGCAGAGATCCGCGGTCAGCACGATTCGG
AGTGGGCAGCGATCAGTGAGGTCGCCCGTCTACTTGGTGTTGGCTGCGCGGAGACGGTGC
GTAAGTGGGTGCGCCAGGCGCAGGTCGATGCCGGCGCACGGCCCGGGACCACGACCGAAG

Thanks

sequencing tool metagenome • 136 views
ADD COMMENTlink modified 4 weeks ago • written 4 weeks ago by m.u0
1

Not sure if applicable here but often X (or x) is used to hard-mask the sequence (eg. for transposable elements or such), while N (n) is used to denote a gap or unknown base in the sequence.

ADD REPLYlink written 29 days ago by lieven.sterck5.8k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 761 users visited in the last hour