Question: (Metagenome) Kraken2 : What is "x" replacing the genome sequence?
0
gravatar for m.u
5 months ago by
m.u0
m.u0 wrote:

Hello, I'm using the standard Kraken 2 database.

What is meant by "x" character replacing the eukaryotic genome sequence in library.fna that is reference genome?

What is different from N?

CCCAAACGACTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxACCCCGCACCAAAAAACATCCNNNNNNNNNNNGGCATGTCCGG
AGACTCCAGTTCTTGGAAAGGATGGGGTCATGTCAGGTGGTTCATCGAGGAGGTACCCGC
CGGAGCTGCGTGAGCGGGCGGTGCGGATGGTCGCAGAGATCCGCGGTCAGCACGATTCGG
AGTGGGCAGCGATCAGTGAGGTCGCCCGTCTACTTGGTGTTGGCTGCGCGGAGACGGTGC
GTAAGTGGGTGCGCCAGGCGCAGGTCGATGCCGGCGCACGGCCCGGGACCACGACCGAAG

Thanks

sequencing tool metagenome • 225 views
ADD COMMENTlink modified 11 weeks ago • written 5 months ago by m.u0

Thank you for your response! I've got it.

ADD REPLYlink written 11 weeks ago by m.u0
1
gravatar for lieven.sterck
5 months ago by
lieven.sterck6.7k
VIB, Ghent, Belgium
lieven.sterck6.7k wrote:

Not sure if applicable here but often X (or x) is used to hard-mask the sequence (eg. for transposable elements or such), while N (n) is used to denote a gap or unknown base in the sequence.

ADD COMMENTlink written 5 months ago by lieven.sterck6.7k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1110 users visited in the last hour