Question: KaKs_calculator doesn't work with sequences
0
gravatar for mar.ark.parr
24 days ago by
mar.ark.parr40
mar.ark.parr40 wrote:

Hi!

Question about KaKs_Calculator2.0

I would like to calculate Ka/Ks for the sequences below. However, the calculator doesn't work with it. The tool doesn't write any error, however the output file is empty. Does anyone have any idea what is the problem?

Kind regards, Marina

sequences

GTGGACGTGCCAATGACTTTGACCAAGGTATAAGGTTGAGCACCGGCTCCCACCGCCCCCATATGGCAATCAAATGCTCCACCAGAAAGGATCACCGTCGTTGGTAAGCCCAGACGCTCAGCCCACTCGGCGGTGATCTGGCCTACCGGTCGTTCGGCGGTGTAGGTGTCAGTAAACATGGGATAATCGAGATCATTAACCAGGCTGGTATCTAATGCCGCGAGGAACGCTCGTGGGGGTAATCCGCCCCATGAAGGGTGCCATAAACTTTTATGTCCGGCGCTGCAACGGCCACGCTGGATATCCTGCGGTGCGGTGGTACCAGACAAGAGGGCCGGTACCCAGTCACACAGCTCAATCCATGACACTGCCGCCTCACGAACAGCCACATC---AGCACGGGTGACATGTAGAATTTTTGCCCAGAACCACTCAGAGGAATAA
GTGGAAGTACCGATCACCTTGCACAACGAATACGGCTCGATCAGCGCCCCTACCGCGCCCATGTGCGCATCAAACGCCCCTACGCCGATCACGACGTTTTCGGGAATGCCCAGCTTTGCCGCCCATTCTTTTGAAATGGTGCCCATCGGTTGGTCGGAAGTTTCGGTGGTGCTGAAAAGG---CGGTCGCGGAGACCGTCGAGCAATGGGTCGAGCTCGGTGAAGAATGCATTGGACGGTAACCCGTCGAAATCCTGGTGCCAGAGCGCTTTGTGCCCTGCGGCGCAGCGCGAACGTTTCAGTTGGAGCGGATCGGTCATGCCCGTGAGCTCGGCAGAAATCCAGTCGCAATGCTCTACCCATGAGAAGGCTTGCTCGCGCACGGCCGTGTC---CACACGTAACGTGCGCAGGATTTTGGCCCAGAACCATTCCGAGGAATAG
sequence gene software error • 130 views
ADD COMMENTlink modified 24 days ago by RamRS24k • written 24 days ago by mar.ark.parr40

Can you give some more info on this? eg. how did you 'pair' the sequences, how did you align them, ...

at first sight it does not seem that the sequences are correctly aligned for doing Ka/Ks calculations on it .

ADD REPLYlink written 24 days ago by lieven.sterck5.9k

Hi! The problem is found and its not in sequences. I filled the input files myself and didn't put "\n" at the end of the file. Ka/Ks Calculator needs it.

@lieven.sterck Thanks for your answer! I have MSA of certain genes and take sequences from there pairwise.

ADD REPLYlink written 24 days ago by mar.ark.parr40

that's fine, just make sure the sequences are aligned in "codon-aware" mode, otherwise your Ka/Ks calculations will not make much sense, unless that software does it itself of course (not familiar with it)

ADD REPLYlink written 24 days ago by lieven.sterck5.9k
1

Thank you for this point! Yes, I currently it is not implemented. I found it can be done with http://translatorx.co.uk/

ADD REPLYlink written 24 days ago by mar.ark.parr40

didn't know about that one but yes indeed it seems so.

ADD REPLYlink written 24 days ago by lieven.sterck5.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1964 users visited in the last hour