Question: I want to use droptag but I don't have the barcodes in .fastq format, they're in .txt ... help ?
0
gravatar for castravete2712
8 months ago by
castravete27120 wrote:

Hello, I need some help.

I have to use droptag on 2 fastq.gz files (an internship assigned work) coming from here

I want to use the droptag utility in order to demultiplex my fastq.gz files (as it extracts the cell barcodes and UMIs from the library): the syntax is like this:

droptag [options] -c config.xml barcode_reads.fastq [barcode_umi_reads.fastq] gene_reads.fastq [library_tags.fastq]

But, droptag needs a .fastq barcode files and all I have are 3 .txt files with the barcodes of the 3 rounds of SPLIT-seq barcoding: Their format is like this: For Round1 and 2:

 #WellPosition  Name    Sequence
    A1  Round1_01   /5Phos/CGCGCTGCATACTTGAACGTGATCCCATGATCGTCCGA
    A2  Round1_02   /5Phos/CGCGCTGCATACTTGAAACATCGCCCATGATCGTCCGA
    A3  Round1_03   /5Phos/CGCGCTGCATACTTGATGCCTAACCCATGATCGTCCGA
    A4  Round1_04   /5Phos/CGCGCTGCATACTTGAGTGGTCACCCATGATCGTCCGA

For Round3:

#WellPosition   Name    Sequence
A1  Round3_01   /5Biosg/CAGACGTGTGCTCTTCCGATCTNNNNNNNNNNAACGTGATGTGGCCGATGTTTCG
A2  Round3_02   /5Biosg/CAGACGTGTGCTCTTCCGATCTNNNNNNNNNNAAACATCGGTGGCCGATGTTTCG
A3  Round3_03   /5Biosg/CAGACGTGTGCTCTTCCGATCTNNNNNNNNNNATGCCTAAGTGGCCGATGTTTCG

I don't know what to do, do I have to write a script? I don't even know for now what a barcode.fastq file should look like. Or is there already an utility that solves this problem? I looked on the web but didn't find anything promising.

And yes, I tried, droptag doesn't work with .txt files.

split-seq rna-seq droptag • 183 views
ADD COMMENTlink modified 8 months ago • written 8 months ago by castravete27120

In fact, it's okay, RNA-seq has the first raw fastq file with only the reads and the second with the barcodes, the demultiplexing phase can compute them together just fine.

ADD REPLYlink written 8 months ago by castravete27120

So did solution suggested by @ale_abd work in your case?

ADD REPLYlink written 8 months ago by genomax89k

No, I couldn't apply it in my case as the output is not really compatible with what droptag is searching for. But it could be a good solution for other people

ADD REPLYlink modified 8 months ago • written 8 months ago by castravete27120
1
gravatar for ale_abd
8 months ago by
ale_abd30
ale_abd30 wrote:

Hello,

I'm not sure how droptag works, but maybe you can use QIIME's extract_barcodes.py script, this script will separate your fastq files into barcodes (fastq format) and sequences. Then you can just use also QIIME's split_libraries_fastq.py to demultiplex your files or give it a try to droptag with the generated files.

If you decided to use split libraries script from QIIME you only need to format your mapping file according to this format.

I hope this helps.

ADD COMMENTlink written 8 months ago by ale_abd30

I'll take a look and try, thank you for your reply :)

ADD REPLYlink written 8 months ago by castravete27120
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1190 users visited in the last hour