How to recognize single-end fastq files
1
0
Entering edit mode
12 months ago
ATCG ▴ 300

Hi, I have fastq files which are all R1 but I want to be sure that they are single-end sequencing ( in case R2 was misplaced for example) I'm unsure if for single-end the 1 from this code 1:N:0:GGAGAA represents one of a pair?? Here is what R1 file looks like:

+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEAEEE
@NS500449:529:HYW33BGX5:1:11101:12403:1046 1:N:0:GGAGAA
CGGAANTTTACGTTCGCTGTGTTTGTGTACGACACAAAGTTTGTGCCAAGTTTTTTAAATCAATTACATTTTTGA


+
AAAAA#6AEE/EEEEEEEEE6EEEEEEEEAEEAEEEEEEEA<<E/AEEAEA/EEAEE//EEEEEEEAAEEEE<E<
@NS500449:529:HYW33BGX5:1:11101:8275:1047 1:N:0:GGAGAA
CGAAGNCCTTGGTTCAAAAGGTTCTGGAGTTCGTGGATGAGCATGGAACCGAGGTGCTTAACCTGGGCAGCTTCA


+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEAEEEEEAE
@NS500449:529:HYW33BGX5:1:11101:19612:1048 1:N:0:GGAGAA
GCAGCNGGCAATAATCTTAATGCCCATGGAATTACTCCGGATAAAGATCTGCCAAAGTCCACGGCAATGCCCAGCA

Thanks for your time!

RNA-Seq Fastq single-end • 220 views
ADD COMMENT
1
Entering edit mode

in case R2 was misplaced

No way to know for sure unless one knew the sample was sequenced as paired-end to begin with.

ADD REPLY
0
Entering edit mode

So there is no way to know just by looking at the file?? That can not be right, not surprising, this information should be encoded in the file!

ADD REPLY
0
Entering edit mode

That information is in the file. 1:N:0:GGAGAA says this is read 1. If it is on its own, it is single-end data (without 2:N:0:GGAGAA to go with it).

ADD REPLY
1
Entering edit mode
12 months ago
swbarnes2 9.8k

I'm unsure if for single-end the 1 from this code 1:N:0:GGAGAA represents one of a pair??

Nope. My single end sequencing has the same thing.

ADD COMMENT

Login before adding your answer.

Traffic: 1045 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6