question regarding splitting fa file with fasplit

Question

[citronxu]

Hello everyone,

I used fasplit to separate my fasta file into two parts, it works fine but some part got dropped.

the code I use faSplit sequence 'myfile' file-number-required 'output_filename'

somehow the gene ID got cut off when the software gonna recognize the sequence boundaries and execute splitting function.

Should I revise the format of my original file which makes the boundaries beyond my gene ID so that it wont be lost? and how?

appreciate any help!

[GenoMax]

Many programs ignore things after first white space in fasta header. See if you can pass the entire header in " to faSplit and see if that helps. Otherwise you will need to change the spaces to _ to make the headers unique.

[Istvan Albert]

there is no need to add an image, the content of your shell is text, highlight the text then paste it into the box, and select "code" formatting, like so:

cat foo.fa

prints:

>foo bar baz
TTAGGAGGAACACCAGTGGCGAAAGCGGCTTACTGGACTGTAAC

[citronxu]

thank you for the advice:)

Answer 1

[Istvan Albert]

Use a different tool, for example seqkit

• https://bioinf.shenwei.me/seqkit/

you can split files by id with:

seqkit split -i foo.fa

[citronxu]

thank you, it works!