Question: How to call and INDEL using GATK
0
gravatar for Manoj
9 weeks ago by
Manoj40
Canada
Manoj40 wrote:

I am using gatk-4.1.7.0 version with following command, however I am getting error. please advice....

Command:

gatk-4.1.7.0$./gatk HaplotypeCaller -R /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa -I /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam -O /home/kumarm/allan-work/RNASEq-alignment/raw_variants.vcf

ERROR:::

A USER ERROR has occurred: The specified fasta file (file:///home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa) does not exist.


Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.

rna-seq snp alignment • 138 views
ADD COMMENTlink modified 6 weeks ago by lakhujanivijay5.1k • written 9 weeks ago by Manoj40

Please check the path you have specified for reference sequence. Error clearly tells that there is no reference fasta in the path provided.

ADD REPLYlink written 9 weeks ago by toralmanvar840

The error because I have not generated .dict and .fai files with reference.fasta. However, now I have provided these so it is showing following ERROR:

A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []


Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.

ADD REPLYlink written 9 weeks ago by Manoj40

Hi I have fastq (MnION) file and a reference fasta file..I have still issue to not getting results ......

--FILE 1

@ID_5331388 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCC +ID_5331388 AAFFFJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJ7FFJJJJJJJJJFJJJFJJJJJJJJJJJJJFJJJJJJJJJJJJJJJ @ID_6694963 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGCTGGGAATTCTCCTCCACTCTGGGATGGGCATTCTCCTCC +ID_6694963 AAAFFJJJJJJJFJJJJJFJJFJJJJJJJJJJJJJJFJJJF<fjjjjjjjjj-aj&lt;-ajf-7jff7--7&lt;7fffjj-&lt;<aa-ff-<faj))-af-----)< p="">

---FILE 2

KF267450.1 TTAAAAGAGATTTTCTATCTACGGATAGTTAGCTCTTTTTCTAGACTCTTGTCTACTCAATTCAACTAAA CGAAATTTTGTCCTTCCGGCCGCATGTCCATGCTGCTGGAAGCTGACGTGGAATTTCATTAGGTTTGCTT

--ERROR--

A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []

ADD REPLYlink written 9 weeks ago by Manoj40
0
gravatar for lakhujanivijay
6 weeks ago by
lakhujanivijay5.1k
India
lakhujanivijay5.1k wrote:

Hi Manoj

That's a header incompatibility issue and can be resolved by editing your reference fasta file. Here are few suggestions:

  1. check the headers of your reference fasta file:

    grep "^>" /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa

  2. check the header of your bam file :

    samtools view -H /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam

If your sequence with header KF267450.1 is not found or partially found in the output from step#2 above,then either you have used a difference reference for alignment or you need to rename the BAM header to match with the reference fasta headers.

ADD COMMENTlink modified 6 weeks ago • written 6 weeks ago by lakhujanivijay5.1k

Thank you for your suggestion. I have figure out by using add read group as following command..

./hisat2 --rg ID:@SRR8136651.1 --rg SM:103 --rg PL:ILLUMINA --rg LB:lib-103 --rg PU:@SRR8136651.1.NoIndex -p 8 -q -x ../file.fastq -S ../file.sam

ADD REPLYlink written 6 weeks ago by Manoj40
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1691 users visited in the last hour