How to call and INDEL using GATK
1
0
Entering edit mode
19 months ago
Kumar ▴ 120

I am using gatk-4.1.7.0 version with following command, however I am getting error. please advice....

Command:

gatk-4.1.7.0$./gatk HaplotypeCaller -R /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa -I /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam -O /home/kumarm/allan-work/RNASEq-alignment/raw_variants.vcf

ERROR:::

A USER ERROR has occurred: The specified fasta file (file:///home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa) does not exist.


Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.

alignment snp RNA-Seq • 620 views
ADD COMMENT
0
Entering edit mode

Please check the path you have specified for reference sequence. Error clearly tells that there is no reference fasta in the path provided.

ADD REPLY
0
Entering edit mode

The error because I have not generated .dict and .fai files with reference.fasta. However, now I have provided these so it is showing following ERROR:

A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []


Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.

ADD REPLY
0
Entering edit mode

Hi I have fastq (MnION) file and a reference fasta file..I have still issue to not getting results ......

--FILE 1

@ID_5331388 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCC +ID_5331388 AAFFFJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJ7FFJJJJJJJJJFJJJFJJJJJJJJJJJJJFJJJJJJJJJJJJJJJ @ID_6694963 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGCTGGGAATTCTCCTCCACTCTGGGATGGGCATTCTCCTCC +ID_6694963 AAAFFJJJJJJJFJJJJJFJJFJJJJJJJJJJJJJJFJJJF<fjjjjjjjjj-aj&lt;-ajf-7jff7--7&lt;7fffjj-&lt;<aa-ff-<faj))-af-----)< p="">

---FILE 2

KF267450.1 TTAAAAGAGATTTTCTATCTACGGATAGTTAGCTCTTTTTCTAGACTCTTGTCTACTCAATTCAACTAAA CGAAATTTTGTCCTTCCGGCCGCATGTCCATGCTGCTGGAAGCTGACGTGGAATTTCATTAGGTTTGCTT

--ERROR--

A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []

ADD REPLY
0
Entering edit mode
18 months ago

Hi Manoj

That's a header incompatibility issue and can be resolved by editing your reference fasta file. Here are few suggestions:

  1. check the headers of your reference fasta file:

    grep "^>" /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa

  2. check the header of your bam file :

    samtools view -H /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam

If your sequence with header KF267450.1 is not found or partially found in the output from step#2 above,then either you have used a difference reference for alignment or you need to rename the BAM header to match with the reference fasta headers.

ADD COMMENT
0
Entering edit mode

Thank you for your suggestion. I have figure out by using add read group as following command..

./hisat2 --rg ID:@SRR8136651.1 --rg SM:103 --rg PL:ILLUMINA --rg LB:lib-103 --rg PU:@SRR8136651.1.NoIndex -p 8 -q -x ../file.fastq -S ../file.sam

ADD REPLY

Login before adding your answer.

Traffic: 2688 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6