how to get fasta files for list of genes?
1
1
Entering edit mode
17 months ago
p • 0

I have list of genes like

LOC109802912

LOC109788332

LOC109789928

LOC109809764 ...

and have a fasta file like

>rna-XR_003803819.1 gene=LOC114915746
TGCTTCTTCTCTGTTGGAAGAGTTTAAAAGCAATAAAACTAAGTGTTTTGAGCTCTCTGAAATTGCTGGT
CATGTTGTTGAGTTCAGTGCGGATCAATATGGGAGCCGATTTATTCAGCAAAAGCTTGAAACAGCTActa
ca

>rna-XR_002239520.2 gene=LOC109794983
TCCTATTCATCATGCAGGATGTCAGAATCTTCATTTCAAATTGGACCAATCCTTCTTGTGAATGAACCCT
TCACGATTGATAATGGTCTAATGACACCTACTTTGAAAATTCGAAGAGATAGAGTTGTGGCTCAATACAG
G

how can i get the fasta sequences for genes?

fasta ngs • 394 views
ADD COMMENT
2
Entering edit mode
17 months ago

Try this:

pip install --user pyfaidx

xargs faidx -d " " YOURFASTA.fasta < GENEID_LIST.txt > extracted_sequences.fasta
ADD COMMENT
0
Entering edit mode

'xargs' is not recognized as an internal or external command, operable program or batch file. I am using window

ADD REPLY
0
Entering edit mode

I am using window

Please mention this from the beginning in your next questions. By using windows you are making things harder for yourself (because fewer tools are available) and for us (because most of us don't use windows for bioinformatics).

ADD REPLY

Login before adding your answer.

Traffic: 1999 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6