Question: miRDeep2 problem with reads_collapsed.fa
0
gravatar for LynxLynx
5 months ago by
LynxLynx0
Russia/St.Petersburg/ITMO
LynxLynx0 wrote:

Hello everyone! I'm trying to run mirdeep2.pl Command I use is following: miRDeep2.pl reads_collapsed.fa Lusitatissimum_200_BGIv1.0.fa SRR8582417.arf none none none

1) reads_collapsed.fa file was created with SAM to ARF built-in mirdeep2 converter and has the following content:

>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG
>seq_2_x1
ATGTCACCGAGTCTGTTACGCAAT
>seq_3_x2
AGGGAAGAAGAACTAATATTTG
.......

2) Lusitatissimum_200_BGIv1.0.fa is my reference genome

3) SRR8582417.arf was generated with converter as well

miRDeep2 starts to run, but then it crashes with the error:

> #testing input files
> #testing input files sanity_check_reads_ready_file.pl reads_collapsed.fa
> 
> started: 23:31:07 Error: problem with reads_collapsed.fa Error in line
> 434.802: Either the sequence contains less than 17 characters or contains characters others than [acgtunACGTUN]
> 
> Please make sure that your file only comprises sequences that have at
> least 17 characters
> 
> containing letters [acgtunACGTUN]

Both statements are false actually and alll files are in the working directory What's the problem?

rna-seq mirdeep2 microrna • 261 views
ADD COMMENTlink modified 5 months ago by di.wang10 • written 5 months ago by LynxLynx0
0
gravatar for Barry Digby
5 months ago by
Barry Digby560
National University of Ireland, Galway
Barry Digby560 wrote:

Take a look at this tutorial A: mireap procedure short tutorial

You will need to split the fasta headers so that the collapsed read counts have a space separating the ID and count using sed

>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG

to

>seq_1_x 1
CTTATAGTGTAAGGTGGAATGAAG
ADD COMMENTlink written 5 months ago by Barry Digby560

Thank you! But there was a test file in mirdeep2/tutorial. I ran mirdeep with my files + this test file and it was ok.

>seq_0_x149538
TCACCGGGTGGAAACTAGCAGT

But this file has the same header' structure as mine. Why does it work?

ADD REPLYlink modified 5 months ago • written 5 months ago by LynxLynx0

sorry, I must have had it confused with mireap. are you sure the sequence lengths are all above 17? you might have to dig deeper into that.

awk '/^>/{if (l!="") print l; print; l=0; next}{l+=length($0)}END{print l}' test.fa > lenghts.txt

and parse output

ADD REPLYlink written 5 months ago by Barry Digby560

I have removed all strings shorter than 18 with mapper.pl reads.fa -c -j -l 18 -m -s reads_collapsed.fa

Just to be sure I also removed all non-printable chrs using command line sed 's/[^[:print:]]//g' reads.fa > clean.fa

Did not help(

Then I just removed line 434.802, didn't help as well

ADD REPLYlink written 5 months ago by LynxLynx0

By the way, the error is still in line 434.802 though I removed it

ADD REPLYlink written 5 months ago by LynxLynx0
0
gravatar for LynxLynx
5 months ago by
LynxLynx0
Russia/St.Petersburg/ITMO
LynxLynx0 wrote:

I just mapped reads again using mirdeep2 and obtained ARF file. So I didn't have to use converter :)

ADD COMMENTlink written 5 months ago by LynxLynx0

It worked? great! So the solution was to remake the arf file?

ADD REPLYlink written 5 months ago by Barry Digby560

Hi,

How did you solve that problem?

My error is #testing input files Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8").

But it didnot say what the problem is.

And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow

In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".

This really annoys me for weeks. Does anyone have idea about this?

Thanks a lot.

Di.

ADD REPLYlink written 5 months ago by di.wang10
0
gravatar for di.wang1
5 months ago by
di.wang10
di.wang10 wrote:

Hi,

How did you solve that problem?

My error is "#testing input files Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8")."

But it didnot say what the problem is.

And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow

In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".

This really annoys me for weeks. Does anyone have idea about this?

Thanks a lot.

Di.

ADD COMMENTlink written 5 months ago by di.wang10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1872 users visited in the last hour