Question: mireap procedure short tutorial
2
gravatar for F
2.1 years ago by
F3.1k
Iran
F3.1k wrote:

sorry,

who know few words about mireap procedure, by googling I could not find even one syntax :(

mirna mireap • 1.3k views
ADD COMMENTlink modified 2.1 years ago • written 2.1 years ago by F3.1k
2
gravatar for Farbod
2.1 years ago by
Farbod3.2k
Toronto
Farbod3.2k wrote:

Dear Angel, Hi

If you want some helps about script and syntax for running this software it is in the README file of the program and is as below, hope that helps:

Program: MIREAP (Reap miRNAs from deeply sequenced smRNA library) Version: 0.2 Contact: Li Qibin liqb@genomics.org.cn Bioinformatics department, Beijing Genomics Institute

1. Introduction MIREAP combines small RNA position and depth with a model of microRNA biogenesis to discover microRNAs from deeply sequenced small RNA library.

2. Installation You must have Vienna RNA Package (http://www.tbi.univie.ac.at/RNA) installed on your computer and make sure that its perl interface is accessible.

Copy mireap_0.2.tar.gz to a directory (/foo/bar) and unpack it by command: tar -zxvf mireap_0.2.tar.gz

Before running mireap, you need add path /foo/bar/mireap_0.1/lib to environment variable PERL5LIB: For csh/tcsh: setenv PERL5LIB /foo/bar/mireap_0.2/lib For sh/ksh/bash: export PERL5LIB=/foo/bar/mireap_0.2/lib

3. Usage

mireap.pl -i <smrna.fa> -m <map.txt> -r <reference.fa> -o <outdir>

Options:

-i <file> Small RNA library, fasta format, forced

-m <file> Mapping file, tabular format, forced

-r <file> Reference file, fasta format, forced

-o <dir> Directory where results produce (current directory)

-t <str> Sample label (xxx)

-A <int> Minimal miRNA sequence length (18)

-B <int> Maximal miRNA sequence length (26)

-a <int> Minimal miRNA reference sequence length (20)

-b <int> Maximal miRNA reference sequence length (24)

-u <int> Maximal copy number of miRNAs on reference (20)

-e <folat> Maximal free energy allowed for a miRNA precursor (-18)

-d <int> Maximal space between miRNA and miRNA* (35)

-p <int> Minimal base pairs of miRNA and miRNA*

-v <int> Maximal bulge of miRNA and miRNA* (4)

-s <int> Maximal asymmetry of miRNA/miRNA* duplex

-f <int> Flank sequence length of miRNA precursor (10)

-h Help

Please convert your small RNA file into fasta format and append sequencing frequence to sequence Id, just like this entry:

t0000035 3234 GAATGGATAAGGATTAGCGATGATACA (t0000035 is read_ID, 3234 is sequencing frequence)

The format of small RNA mapping file should be (delimited by tab or space): read_ID,chr_ID,start,end,strand(+/-)

You can make MIREAP run on the test data by execute comand: perl ../bin/mireap.pl -i rna.fa -m map.txt -r ref.fa .

.

4. Output format MIREAP produce three files at each run.

*.gff This file contains miRNA genes discovered by MIREAP, GFF3 format. For GFF3 format, please refer to http://www.sequenceontology.org/gff3.shtml Attribute 'Count' denotes the sequenceing frequence.

*.aln This file contains sequence and structure of the pre-miRNA. Small RNAs also are aligned to the precursor from which you can get more insights into the maturation process of miRNAs.

*.log This log file records parameters, start end time and other informations.

ADD COMMENTlink modified 2.1 years ago • written 2.1 years ago by Farbod3.2k
1

thank you so much, sorry do you know how to provide map.txt file???

ADD REPLYlink written 2.1 years ago by F3.1k
1

Dear Angel, Hi.

There is already a map.txt file exists in the "mireap_0.2.tar.gz" file and after extraction you can find it. Do you mean that file ?

This is the head of that (it has about 110951 rows):

t0000035 nscaf1690 4798998 4799024 +

t0000035 nscaf1690 4805385 4805411 +

t0000035 nscaf1690 7588502 7588528 +

t0000072 nscaf1690 2923961 2923988 -

t0000093 nscaf1690 784585 784612 +

t0000093 nscaf1690 1539278 1539305 +

t0000093 nscaf1690 2223484 2223511 +

t0000093 nscaf1690 5848415 5848442 +

t0000093 nscaf1690 7501339 7501366 +

t0000093 nscaf1690 2400901 2400928 -

t0000093 nscaf1690 3005327 3005354 -

ADD REPLYlink modified 2.1 years ago • written 2.1 years ago by Farbod3.2k
1

merc Farbod jan,

I mean how to create my own map file :(

ADD REPLYlink written 2.1 years ago by F3.1k
1

Sorry because of that. As I usually work with miRDeep2 and miRDeep2Star I am not familiar with Mireap software (what is your species of interest? is there any reference genome available for it?).

It seems that in this paper they have used Mireap program, maybe you can email them.

ADD REPLYlink modified 2.1 years ago • written 2.1 years ago by Farbod3.2k
1

sorry may I have youe email please because I am also working with mirdeep2 and fully stuck on :( :( :(

ADD REPLYlink written 2.1 years ago by F3.1k

I don't think Biostars allows requests for personal email addresses. Since there is no facility to private message a user you have no option but to keep all dialog public.

ADD REPLYlink modified 2.1 years ago • written 2.1 years ago by genomax57k
1

thank you, you all right. he is an Iranian alike me then I thought I could help because we are closer

ADD REPLYlink written 2.1 years ago by F3.1k
1

I have also heard about a program called miRNAkey that is very user friendly with a GUI and automatic DEmiRNA analysis. If you are not very strict of the algorithms that the software use, you can try it , too.

ADD REPLYlink written 2.1 years ago by Farbod3.2k
0
gravatar for F
2.1 years ago by
F3.1k
Iran
F3.1k wrote:

https://github.com/liqb/mireap

ADD COMMENTlink written 2.1 years ago by F3.1k
1
gravatar for natasha.sernova
2.1 years ago by
natasha.sernova3.1k
natasha.sernova3.1k wrote:

Change case to MIREAP, you will be more successful.

There is even post in biostars.org with another choice:

Using Mireap for the Plant miRNA discovery

ADD COMMENTlink modified 2.1 years ago • written 2.1 years ago by natasha.sernova3.1k
1

thank you but nothing yet :(

ADD REPLYlink written 2.1 years ago by F3.1k

I've found this site:

http://www.mireap.net/geninfo.php

ADD REPLYlink written 2.1 years ago by natasha.sernova3.1k
1

thank you but this is not related at all and is something else

ADD REPLYlink written 2.1 years ago by F3.1k
1

https://sourceforge.net/projects/mireap/

I hope this is what you are looking for.

or this one as a branch of the above:

https://sourceforge.net/projects/mireap/?source=navbar

ADD REPLYlink modified 2.1 years ago • written 2.1 years ago by natasha.sernova3.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1689 users visited in the last hour