Question: Does anyone have experience of methylation alignment tool "Bismark"?
0
gravatar for kwanghoon
4 weeks ago by
kwanghoon10
kwanghoon10 wrote:

Hi, I'm trying to align my methylation data using Bismark

I did something.... so I got .bam file. I converted it to .sam to see how it looks like.

I saw weird thing(sequence?) like

K00171:752:HW5LHBBXX:4:1207:3082:33457_1:N:0:CGACACAC 83 chr1 10003 6 101M = 10009 -107 ACCCTAGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC TAACCCTAACCCTAACCCTAACCCTAACCCT **-JJJA7-JJJFF7JJJJA-FJJAJJFJJJF7JJJJFAJJJJJFJJJF<fjjjjjjjjjjffjjjfffjjjjjfjjjjffjjjjjjjjjjjjjjjjjfffaa nm:i:1="" md:z:6a94="" xm:z:.........................="" ............................................................................="" xr:z:ct="" xg:z:ga<="" p="">

What does this mean?

-JJJA7-JJJFF7JJJJA-FJJAJJFJJJF7JJJJFAJJJJJFJJJF<fjjjjjjjjjjffjjjfffjjjjjfjjjjffjjjjjjjjjjjjjjjjjfffaa< strong="">

bismark methylation ngs • 96 views
ADD COMMENTlink modified 4 weeks ago by MatthewP690 • written 4 weeks ago by kwanghoon10
1
gravatar for MatthewP
4 weeks ago by
MatthewP690
China
MatthewP690 wrote:

Hey, go see Bismark Docs you will see this field is QUAL which means sequencing quality, so this should the same with quality value in fastq file.

ADD COMMENTlink written 4 weeks ago by MatthewP690

yeah I saw that docs too. I was not sure about that so I made question. Anyway thank you!

ADD REPLYlink written 4 weeks ago by kwanghoon10
1

If an answer was helpful, please indicate that by upvoting.

You can also find more information about sequencing quality scores in the description of FASTQ files

ADD REPLYlink written 4 weeks ago by Friederike5.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1533 users visited in the last hour