Hello,
I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:
I'm wondering if they mean that I need to include the reverse complement of the unique adapter into the primer that I will use to amplify my tagmented DNA, or whether this is specified at the sequencer to accommodate for differences between in how reads are generated?
For example, a standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
What should I order to amplify my transposed libraries? The H502 i5 index: unique i5 bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably because they used a different sequencer: [url]https://www.encodeproject.org/documents/4a2fc974-f021-4f85-ba7a-bd401fe682d1/@@download/attachment/RenLab_ATACseq_protocol_20170130.pdf[/url]
From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index for PCR, but they've also added a few bases (AGATGT) to the 3' end of the i7 adapters that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?
Best, Eric
You could do what @ATpoint said below or order a kit.
Edit: Took out example link since it was not appropriate.
This kit is for TruSeq, but ATAC-seq is based on the Nextera adapter, so this will not work.
Brilliant! Thanks to you both for your replies and information. The excel spreadsheet is a game changer.
Best, Eric
You can accept @ATPoint's answer (green check mark) to provide closure to the thread.
Sure thing. I also edited my post and included a paper which lists these primers from the lab that developed ATAC-seq in case you want to double-check with an "official" resource.