extract stem-loop fasta sequence
0
0
Entering edit mode
10 months ago

Hello to all I have a series of Small RNA-seq data that was actually the output of the mapping reads Small RNA-seq with mirbase database by Genomic CLC software. Now I need to use the mapping output to get the sequences conseve using the accession number of the stem-loop structures on the mirbase database. Someone can help me with the awk or grep command.

this is my fasta sequence conserve from mapping clcl genomic

>MIR156d//MIR156a//MIR156f_Cucumis_melo//Manihot_esculenta//Brachypodium_distachyon//Asparagus_officinalis
TGACAGAAGAGAGTGAGCAC
>MIR157a//MIR157b//MIR157c//MIR156b//MIR156c_Arabidopsis_thaliana//Solanum_lycopersicum
TTGACAGAAGATAGAGAGCAC
>MIR157d//MIR156i_Arabidopsis_thaliana//Fragaria_vesca
TGACAGAAGATAGAGAGCAC
>MIR159_Aquilegia_caerulea
TTTGGACTGAAGGGAGCTCTA

precursor from hairpin.fa download from mirbase

>cel-mir-2 MI0000004 Caenorhabditis elegans miR-2 stem-loop
UAAACAGUAUACAGAAAGCCAUCAAAGCGGUGGUUGAUGUGUUGCAAAUUAUGACUUUCA
UAUCACAGCCAGCUUUGAUGUGCUGCCUGUUGCACUGU
>cel-mir-34 MI0000005 Caenorhabditis elegans miR-34 stem-loop
CGGACAAUGCUCGAGAGGCAGUGUGGUUAGCUGGUUGCAUAUUUCCUUGACAACGGCUAC
CUUCACUGCCACCCCGAACAUGUCGUCCAUCUUUGAA
>cel-mir-35 MI0000006 Caenorhabditis elegans miR-35 stem-loop
UCUCGGAUCAGAUCGAGCCAUUGCUGGUUUCUUCCACAGUGGUACUUUCCAUUAGAACUA
UCACCGGGUGGAAACUAGCAGUGGCUCGAUCUUUUCC
>cel-mir-36 MI0000007 Caenorhabditis elegans miR-36 stem-loop
CACCGCUGUCGGGGAACCGCGCCAAUUUUCGCUUCAGUGCUAGACCAUCCAAAGUGUCUA
UCACCGGGUGAAAAUUCGCAUGGGUCCCCGACGCGGA
next-gen RNA-Seq • 235 views
ADD COMMENT
0
Entering edit mode

You would need to convert the U to T in the miRbase data (sed 's/U/T/g' hairpin.fa > converted.fa). Once you do that you would be able to use blat (or grep) to find your sequences in the file above. You may have to linearize the fasta sequences before plain grep search.

ADD REPLY
0
Entering edit mode

thank you for comment

ADD REPLY

Login before adding your answer.

Traffic: 1746 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6