Cigar And Sequence Length Inconsistent
0
1
Entering edit mode
13.3 years ago
Bnfoguy ▴ 70

Hello Everyone,

I have been working with cancer exome data and I have two fastq files. I put these files into stampy for paired end mapping and got a sam file. Unfortunately, the stampy script crashed after running close to 10 hours. When I tried to convert the .sam file to bam for mat I get the following error:

CIGAR and Sequence length are inconsistent

Here are the offending lines:

ERR035488.960541        147     chr1    27205782        99      72M     =       27205550        -304    TATGCCTCCTTGAGTGTCAGTGGCGTGATCTTGGCCCGGCTCACACCGGCCGGCAGGAAGTCTAGTAGGCAG       8<=21<?7A<<DA8>>@CEDE.D<DDB?@;BAC6;48EB@AE4>4@&FEB6FEFGFD1GFAC@DFAFBCBB>        PQ:i:46 SM:i:96 UQ:i:0  MQ:i:96 XQ:i:15 NM:i:0


ERR035488.889173        147     chr1    24870728        99      72M     =       24870687        -113    TCATTTTGTTTTGAGAAGTAGCAAAATTGTTTTTTCTACTAATTAGCCAGTTACTCTGAGATAAAAGTCACG       <@<?@BCFFEGFHFHHIICIHEFHHGGFGGFGGGCGC?GCGFFCIGGHGHFC@G@GEGHGECFFEGE?D::?        PQ:i:49 SM:i:96 UQ:i:0  MQ:i:96 XQ:i:34 NM:i:0

What can I do to solve this problem?

Best,

Bnfoguy

cigar sequence length samtools • 7.1k views
ADD COMMENT
2
Entering edit mode

You say the script crashed, but still gave a SAM file? Did you look at the tail of the SAM file to see if it is truncated? if it is, you can get rid of the truncated line and convert what's left to BAM.

ADD REPLY
0
Entering edit mode

There seems to be no inconsistency with the CIGAR string and read length. I'd first check seidel's suggestion.

ADD REPLY
0
Entering edit mode

Base quality string looks incorrect for first read (length inconsistency). Don't know if it's the reason why aligner is crashing.

ADD REPLY
0
Entering edit mode

Ashwin, are you sure you accounted for the HTML in the quality?

ADD REPLY
0
Entering edit mode

this is a Biostar display error, the rendering protection thinks that some of the content in the quality may be an HTML tag and is therefore escaped as [HTML]

ADD REPLY
0
Entering edit mode

Think there should be a way to post plain texts in posts without any html-or any extra validation.

ADD REPLY
0
Entering edit mode

Either way the quality string looks incorrect.

ADD REPLY

Login before adding your answer.

Traffic: 4263 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6