Question: phred score per base sequence quality
0
gravatar for yueli7
29 days ago by
yueli7190
China
yueli7190 wrote:

Hello,

I have RNA sequencing data. After running FastQc, it comes out bad result.

Do I need to fix it?

Thanks in advance for any great help!

Best,

Yue

Screenshot-from-2021-01-26-22-01-44

rna-seq • 120 views
ADD COMMENTlink modified 28 days ago • written 29 days ago by yueli7190
2
gravatar for hafiz.talhamalik
28 days ago by
Pakistan
hafiz.talhamalik290 wrote:

only the quality of 1st base is bad. rest is fine. you can simply trim that.. and I think only one base not gonna cause many problems..!!

ADD COMMENTlink written 28 days ago by hafiz.talhamalik290

Hello hafiz.talhamalik,

Thank you so much for your help!

li@li-HP-P:~/Trimmomatic-0.39$ java -jar trimmomatic-0.39.jar PE P01_1.txt.gz P01_2.txt.gz P01_1_paired.fastq.gz P01_1_unpaired.fastq.gz P01_2_paired.fastq.gz P01_2_unpaired.fastq.gz ILLUMINACLIP:NexteraPE-PE.fa:2:30:10 LEADING:18 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticPE: Started with arguments:
P01_1.txt.gz P01_2.txt.gz P01_1_paired.fastq.gz P01_1_unpaired.fastq.gz P01_2_paired.fastq.gz P01_2_unpaired.fastq.gz ILLUMINACLIP:NexteraPE-PE.fa:2:30:10 LEADING:18 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 85895601 Both Surviving: 61758053 (71.90%) Forward Only Surviving: 23407882 (27.25%)         Reverse Only Surviving: 283767 (0.33%) Dropped: 445899 (0.52%)
TrimmomaticPE: Completed successfully
ADD REPLYlink modified 15 days ago • written 15 days ago by yueli7190
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1747 users visited in the last hour
_