Mapping a short primer sequence to a whole genome
1
0
Entering edit mode
6 weeks ago

I have a degenerate primer pair that I want to independently (so each primer used as a reference) align to a whole genomes. From this I want to take the base number at the start of the alignment for the forward primer and the end value for the reverse primer. I will then take the sequence in-between these two sites and expand it ~100 bp in either direction. Essentially I want to so an in silico style PCR.

Reference primers

>A3F_primer_NRPS_AD_domain
GCSTACSYSATSTACACSTCSGG

>A7R_primer_NRPS_AD_domain
SASGTCVCCSGTSCGGTA

Alignment

I am wanting to/have used BBMap but the output SAM files seem to lack any indication of a a successful mapping? Secondly, why are the "Read Sequences" longer than the reference sequence?

tig00000006_np1212 724352_part_1152     4       *       0       0       *       *       0       0       CACCGCCATGGGCCCTTGCTAGCGGATCGGGCCCGCACTCCGCATCCCAGGGTGTCCTTACCGGCGGGGCCGGCCGCACCCGTCCGGTACGCCGTCCGCCCCCCGTCCCGCACGCCCCACCCCGCCCGCCGTA
tig00000006_np1212 724352_part_1153     4       *       0       0       *       *       0       0       GACGAGCCGGGGATCGTGGGGGCGGCGGCCCGGCTCGGGGTGCCGGTGCGCACCCATCCGGCCGGGGCGCTGGCCGCGGTCCGCGTGCCGCATCCGTCGGACGCGGTGGGCGCGGCGGTGGGGACCCCGTCGG
tig00000006_np1212 724352_part_1154     4       *       0       0       *       *       0       0       GTCGCTCGCCTCCCTCGCCGCCTACCCCGACGGGTCCTCCGCCCGCGTGGCGGTCGCCGACCGGCACGGGCTGCCGGCGGACCGGGTGCTGCTGACGGCGGGCGCGGCCGAGGCGTTCGTCCTGATCGCGCGG
tig00000006_np1212 724352_part_1155     4       *       0       0       *       *       0       0       GGATCGGCTACGTGCTGGCCGATCCGGAGACGGTGGCGCTGCTGGCCGACGCGCAGCCGCTGTGGCCCGTCTCGACCCCGGCGCTCGCGGCGGCCGAGGCGTGCATGGAGCCGCGGGCGCTGGTGGAGGCGGC
tig00000006_np1212 724352_part_1156     4       *       0       0       *       *       0       0       GAAGGGGCCGGGCCGACGCGGTTCGCGTACGAGTGGCGGTGGACGGGGCGGCAGGGCGCCGAGGCCGTTCCCCTGACGGCCGGGGAGGGGCGGGGCCCGGTGTCGGGCCCCGCCCCGGACGCGCTACGGCGTC
tig00000006_np1212 724352_part_1157     4       *       0       0       *       *       0       0       CGGGGTCTCGCAGGTGGCCTCGGCGAGGGTGACCTCGCCGTTCACCTCGGCCACGTTCAGCTTGAGCGGGTTGACCGCGACCTTGAGCTGGAGCGCCGTCGCGGCCGCCGTCCGCTCGGTGGTCACCGTCTTG
tig00000006_np1212 724352_part_1158     4       *       0       0       *       *       0       0       CCTCGTTGAGCGTGGCCTTGAGGGGCACGTGGACGGACTTGTTGAGGAGCGAGACGTTGAGCCCGGTGCGGAGCACGACCGCGCTCGCCCGGCCCTCGCCCTTGCCGGGCGTCGCCGGGGCTGCGTGCGCGGG
tig00000006_np1212 724352_part_1159     4       *       0       0       *       *       0       0       TCGTCAACACGGCTCCCCGCAGCGCGCCGCGTCCGCTCACCCGACGGCGCCGCCGTTCCGGGTCACCCGACCACCCGCCCTTCGAGCACGACGTGCCGCGGGGCCGCCAGCACCCGCACGTCCGCGCGCGGGT
alignment • 108 views
ADD COMMENT
0
Entering edit mode

This seems to be a tool for generating primer pairs?

ADD REPLY
0
Entering edit mode

also for searching user provided primer sequences in user provided sequence with restrictions on degeneracy. For test primer set on test sequence:

Screenshot-2021-02-26-Primer-Blast-results

ADD REPLY
0
Entering edit mode

How did you achieve this? When I give only an input fasta and the two primer sequences I get the error indicating it does not allow for degeneracy in the primers I think: Exception error: Multiple templates are currently not supported! .

ADD REPLY
0
Entering edit mode
6 weeks ago

Try seqkit amplicon - for retrieving amplicon (or specific region around it) via primer(s).

ADD COMMENT

Login before adding your answer.

Traffic: 1655 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6