Question: 200Bp Long Query Returning 201Bp
3
gravatar for secretjess
7.7 years ago by
secretjess180
Cambridge
secretjess180 wrote:

In Ensembl when I use this link to return the sequence on the sense strand of X chromosome between 200000 and 200200 I get the following output:

>X dna:chromosome chromosome:GRCh37:X:200000:200200:1
CCAAACCCCAGGCAGGAGACCAGCCCGTGTTATACGGTGCCTGGAGGAGGCGTGACTCAT
TTGCATAGCGCTGAGGGGATTGGTCTGACCAGGCCTGTCATTCACGTAGCCCGCGAAAAA
CCTGGCCCGCCCACCCCAGTTCCGTAATATGCAAATGTAGGGCGCCATGATGTTCCACAC
GCCTGAGGGTAGTGGGGGCGG

This contains 201 nucleotides, but from my query I was expecting 200. Where has this extra nucleotide come from? Which position is it at? Is my query wrong?

ensembl sequence • 2.6k views
ADD COMMENTlink modified 7.7 years ago by Istvan Albert ♦♦ 85k • written 7.7 years ago by secretjess180
9

This is absolutely fine. Look, if you specify your range as 200000:200001 you will have two nucleotides: (1) C at position 200000 and (2) C at position 200001. So, length = end - start +1.

ADD REPLYlink written 7.7 years ago by a.zielezinski9.3k
2

To complete the answer: this is because Ensembl uses closed intervals both for end and beginning coordinates (ie. your end coordinate will be considered as the last one of the interval).

ADD REPLYlink written 7.7 years ago by vodka80

That's a really good way of explaining it - makes complete sense now, thank you!

ADD REPLYlink written 7.7 years ago by secretjess180
4
gravatar for Istvan Albert
7.7 years ago by
Istvan Albert ♦♦ 85k
University Park, USA
Istvan Albert ♦♦ 85k wrote:

This has been answered above C: 200bp long query returning 201bp by a.zielezinski just adding it here to mark the question as answered.

The choice of interval representation (zero or one based) has advantages and disadvantages that have long intrigued people. It is a non-trivial matter and has many implications as demonstrated by numerous posts here and elsewhere

and many others

ADD COMMENTlink modified 7.7 years ago • written 7.7 years ago by Istvan Albert ♦♦ 85k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1151 users visited in the last hour