Question: What Is The Actual Illumina Smallrna Seq 3' Adapter
0
gravatar for Bharat Iyengar
6.6 years ago by
Bombay, India
Bharat Iyengar270 wrote:

This is the sequence of illumina small RNA seq 3' adapter as reported everywhere:

TCGTATGCCGTCTTCTGCTTGT

if i trim this adapter only 0.2% of all the reads are trimmed.

Just by casual observation I noticed that the sequence "TGTAGGCACCA" is present in the 3' of 50% of the reads. It is not the case with another sample.

Is there a standard adapter sequence? If not then is there a tool for finding any unknown adapter? biopieces find_adaptor doesnt look for all kinds of possible adapters.

illumina • 5.4k views
ADD COMMENTlink modified 7 days ago by oweitu10 • written 6.6 years ago by Bharat Iyengar270
1
gravatar for Rm
6.6 years ago by
Rm7.9k
Danville, PA
Rm7.9k wrote:

Check the Kit you used for library preparation; We have "TGGAATTCTCGGGTGCCAAGG" as 3prime adapter sequence. Did you tried fastx tool kit for adapter clipping (fastx_clipper)?

ADD COMMENTlink written 6.6 years ago by Rm7.9k

this is not my data.. i am doing analysis of a data which i downloaded from SRA.. yes I was using fastx_clipper, but the adapters vary from sample to sample..

ADD REPLYlink modified 6.6 years ago • written 6.6 years ago by Bharat Iyengar270
1
gravatar for oweitu
7 days ago by
oweitu10
oweitu10 wrote:

This is quite late but may be of use to someone like me down the road.

Eurofins published a list of adapters so maybe you can input the relevant ones into your trimming program; http://www.eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf

Best of luck.

ADD COMMENTlink written 7 days ago by oweitu10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1296 users visited in the last hour