What Is The Actual Illumina Smallrna Seq 3' Adapter
2
1
Entering edit mode
11.2 years ago

This is the sequence of illumina small RNA seq 3' adapter as reported everywhere:

TCGTATGCCGTCTTCTGCTTGT

if i trim this adapter only 0.2% of all the reads are trimmed.

Just by casual observation I noticed that the sequence "TGTAGGCACCA" is present in the 3' of 50% of the reads. It is not the case with another sample.

Is there a standard adapter sequence? If not then is there a tool for finding any unknown adapter? biopieces find_adaptor doesnt look for all kinds of possible adapters.

illumina • 12k views
ADD COMMENT
2
Entering edit mode
11.2 years ago
Rm 8.3k

Check the Kit you used for library preparation; We have "TGGAATTCTCGGGTGCCAAGG" as 3prime adapter sequence. Did you tried fastx tool kit for adapter clipping (fastx_clipper)?

ADD COMMENT
0
Entering edit mode

this is not my data.. i am doing analysis of a data which i downloaded from SRA.. yes I was using fastx_clipper, but the adapters vary from sample to sample..

ADD REPLY
2
Entering edit mode
4.6 years ago
oweitu ▴ 20

This is quite late but may be of use to someone like me down the road.

Eurofins published a list of adapters so maybe you can input the relevant ones into your trimming program; http://www.eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf

Best of luck.

ADD COMMENT

Login before adding your answer.

Traffic: 1529 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6