Question: Reverse Read Direction In A Bam File
gravatar for lin.barnum
6.9 years ago by
lin.barnum230 wrote:

I have a bam alignment file with SOLiD mate-pair data (R3/F3). I want to reverse the second read so that it points towards the first read instead of in the same direction.

------>R3       ------>F3


------>R3       <------F3

What I want to know is if it is enough to identify the F3 reads and change the 0x10 flag which indicates SEQ being reverse complemented or would I need to reverse complement the SEQ in column 10, QUAL in column 11, and the CIGAR string to end up with a valid bam file? Anything that I might be missing in this operation?

bam • 4.1k views
ADD COMMENTlink modified 6.9 years ago by Pierre Lindenbaum128k • written 6.9 years ago by lin.barnum230
gravatar for Devon Ryan
6.9 years ago by
Devon Ryan95k
Freiburg, Germany
Devon Ryan95k wrote:

You won't need to reverse complement the sequence and qual fields, those are always 5'->3' of the + strand. However, you will need to change the flags of the R3 read to add the 0x20 flag (in addition to changing the F3 flag).

ADD COMMENTlink written 6.9 years ago by Devon Ryan95k

Thanks, so would the following gawk script accomplish the reversal of the reads properly? gawk 'BEGIN{OFS="\t"}{if (and($2, 0x40)){$2=xor($2, 0x20)} else if (and($2, 0x80)){$2=xor($2, 0x10)} print $0}'

ADD REPLYlink modified 6.9 years ago • written 6.9 years ago by lin.barnum230

I'm not overly familiar with gawk, but that at least looks correct.

ADD REPLYlink written 6.9 years ago by Devon Ryan95k

you also have to check that both reads are on the same chromosome, the distance between the reads.

ADD REPLYlink written 6.9 years ago by Pierre Lindenbaum128k

Why would the distance between the reads change?

ADD REPLYlink written 6.9 years ago by lin.barnum230

it wont change, but if they're too far (e.g 10Mb) , they cannot be "properly paired"

ADD REPLYlink written 6.9 years ago by Pierre Lindenbaum128k
gravatar for Pierre Lindenbaum
6.9 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum128k wrote:

OK I wrote a java program for this. I pushed it on github :

before :

samtools view src.bam | grep "HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906"
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        177     3       1264832 37      101M    =       1264940 109     AGGTGGTGAAGCATGAGATGTAGGGAGAGCTGCTTTAAAACCCAGCACAAGGCTGGTTGTACTGGCTCACACCTGTAATCCCAGGTCTTTGGGAGGCTGAG    """#""""#"""#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#""""""#""##"""""""#"#"   X0:i:1  X1:i:0  BD:Z:ABBACCABBABAAABABAABAACBBABAA@AAABAABBAABB@AAAAAAABA@ABAA@BAA@@BAAAAAAAA@@BAAAABA@ABAAABAACBBACBAABAA       MD:Z:0C0C0C1C0C0G1G0T1T0T0G0C0C0T0T0C0T0G0T0A0C0A2T2C0A0T0G0C1T0G0T0G2G0T0T0T0G1G0T1T1C0C0A0A0G0T0G0C0G0A1T0G1G0C0T1T0T2C0G0T0G0T0G1C1C0A1G1G0T1C0C1T0T2C0A0     RG:Z:idp63088   XG:i:0  BI:Z:ABBAEDCCCBCBBABABAAAA@CBBAB@A@@A@AAAAAAABA@@AAA@A@BA@@BAA@A@@@@BAA@A@@@A@@AAAAABA@@BAAABBACBBACBBABAA       AM:i:37 NM:i:75 SM:i:37 XM:i:1  XO:i:0  MQ:i:37 XT:A:U


 java -jar dist/biostar76892.jar ONLYSAVEFIXED=true \
    IN=src.bam \
    OUT=fix.bam  \


samtools view fix.bam | grep "HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906"
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        163     3       1264832 37      101M    =       1264940 109     AGGTGGTGAAGCATGAGATGTAGGGAGAGCTGCTTTAAAACCCAGCACAAGGCTGGTTGTACTGGCTCACACCTGTAATCCCAGGTCTTTGGGAGGCTGAG    """#""""#"""#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#""""""#""##"""""""#"#"   X0:i:1  X1:i:0  BD:Z:ABBACCABBABAAABABAABAACBBABAA@AAABAABBAABB@AAAAAAABA@ABAA@BAA@@BAAAAAAAA@@BAAAABA@ABAAABAACBBACBAABAA       MD:Z:0C0C0C1C0C0G1G0T1T0T0G0C0C0T0T0C0T0G0T0A0C0A2T2C0A0T0G0C1T0G0T0G2G0T0T0T0G1G0T1T1C0C0A0A0G0T0G0C0G0A1T0G1G0C0T1T0T2C0G0T0G0T0G1C1C0A1G1G0T1C0C1T0T2C0A0     RG:Z:idp63088   XG:i:0  BI:Z:ABBAEDCCCBCBBABABAAAA@CBBAB@A@@A@AAAAAAABA@@AAA@A@BA@@BAA@A@@@@BAA@A@@@A@@AAAAABA@@BAAABBACBBACBBABAA       AM:i:37 NM:i:75 SM:i:37 XM:i:1  XO:i:0  MQ:i:37 XT:A:U  rv:i:1
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        83      3       1264940 37      101M    =       1264832 -109    GGTATCTCCATGCTCGAAGCCCTGACCTACTGTATTGCCCCGAAAGTCTTCCCTGCTGTGGCTGCATCTTTTCCACGTGGATAATCTTGGTTCATCTCTAG    """##"""""""""""""""""""""""""#"""""""""""""""""""""""""""#"""""""""""""""#""""""""""""#""#""##"#"##"   X0:i:1  X1:i:0  BD:Z:BBAABBBBAAABBBCBAABCBA@BAAAAAAABAAAAACCCBABAAAAAAACBAAAAABABA@AA@AAABBAAAAACB@BBAAAAAAAABBBAABBBBAAAA       MD:Z:0T0T1G0C0A1G0T1C0C0A1G0T0G0C0A0T0G0T0G0T0G2A0T4G0C0A0A0T0G0T0G0C1G0G0T0G1C0A0G0T0T0G0C0A4C1A0T0G0C0G0T0G2G0G1C0G0T0G0A1C0G0T0G1G0C2T2T0C0G0T0G0T0A0T1       RG:Z:idp63088   XG:i:0  BI:Z:BABADDCCBBBCBBCBAABCBA@AABAAA@AAAAA@BBBBBAAA@AA@AABA@@A@@A@BA@@A@AA@AAAAAAABB@BAAAAAAAA@CBAAABBBBAAAA       AM:i:37 NM:i:74 SM:i:37 XM:i:0  XO:i:0  MQ:i:37 XT:A:U  rv:i:1
ADD COMMENTlink written 6.9 years ago by Pierre Lindenbaum128k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1135 users visited in the last hour