Entering edit mode
10.3 years ago
win
▴
970
hi all, i have a set of sequences such as
GTGAGCACTCATGAACAGTCTGAGTCCGCCCATGGACGCACAGGGCCCAGCACTG(G-C)AGGAAGACAAAGATCCCGCCACGAGCAGGCACGAGACAGCTCCAGGCACTCAGCGT
what i want is the genomics coordinates for the location of the SNP. I want to use those coordinates to query microarray data and VCF data.
any resources online that will allow for such batching.
thanks in advance.
Just use the WT (without the SNP) sequence or enable at least one mismatch if you use a short read aligner.