Question: Genomics Coordinates From Sequences
0
gravatar for win
5.4 years ago by
win810
India
win810 wrote:

hi all, i have a set of sequences such as

GTGAGCACTCATGAACAGTCTGAGTCCGCCCATGGACGCACAGGGCCCAGCACTG(G-C)AGGAAGACAAAGATCCCGCCACGAGCAGGCACGAGACAGCTCCAGGCACTCAGCGT

what i want is the genomics coordinates for the location of the SNP. I want to use those coordinates to query microarray data and VCF data.

any resources online that will allow for such batching.

thanks in advance.

genomic • 1.1k views
ADD COMMENTlink modified 5.4 years ago by swbarnes25.5k • written 5.4 years ago by win810
0
gravatar for swbarnes2
5.4 years ago by
swbarnes25.5k
United States
swbarnes25.5k wrote:

Use BLAST, or a short-read aligner, if you have one.

ADD COMMENTlink written 5.4 years ago by swbarnes25.5k

Just use the WT (without the SNP) sequence or enable at least one mismatch if you use a short read aligner.

ADD REPLYlink written 5.4 years ago by IV1.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1085 users visited in the last hour