Genomics Coordinates From Sequences

Question

[win]

hi all, i have a set of sequences such as

GTGAGCACTCATGAACAGTCTGAGTCCGCCCATGGACGCACAGGGCCCAGCACTG(G-C)AGGAAGACAAAGATCCCGCCACGAGCAGGCACGAGACAGCTCCAGGCACTCAGCGT

what i want is the genomics coordinates for the location of the SNP. I want to use those coordinates to query microarray data and VCF data.

any resources online that will allow for such batching.

thanks in advance.

Answer 1

[swbarnes2]

Use BLAST, or a short-read aligner, if you have one.

[IV]

Just use the WT (without the SNP) sequence or enable at least one mismatch if you use a short read aligner.