Question: Finding Reads Joining Exons From Tophat Output
0
gravatar for hbw
5.0 years ago by
hbw70
United States
hbw70 wrote:

I did an alignment with tophat, supplying the GFF file for gene annotations, and the chromosomes fasta (in bowtie2 index format). I converted the output accepted_hits.bam to sam. In the SAM header, it is listing all the chromosomes, and the reads are mapped to the chromosmes, like this:

266GRCF1GCCAAT:1:1101:8591:43171        0 NC_000076.6   38894021        50      49M     *       0       0       GGCGGGGGGAGGGTATCATGGACTTTTGGGATAGCATTTGAAATATAAA      @@@DDDDDB6BBB+8>CDDCCCCCCCCCBB?ACCCCECCCCCCACCCDE AS:i:0 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:49 YT:Z:UU NH:i:1
266GRCF1GCCAAT:1:2211:7290:90876        0 NC_000076.6   38894073        50      49M     *       0       0       AGAAAATATGTTAAAAATGTTTTGGAAAAAAGAAAAAAAGAAAATTGCC      CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJ AS:i:0 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:49 YT:Z:UU NH:i:1
266GRCF1GCCAAT:1:2202:7215:55833        0 NC_000076.6   38894074        50      49M     *       0       0       GAAAATATGTTAAAAATGTTTTGGAAAAAAGAAAAAAAGAAAATTGCCA      @CCFFFFFHHHHHJJJJIGIJJJIJJIIIIGIIIIGGEGHJIJIEGHII AS:i:0 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:49 YT:Z:UU NH:i:1

Where are the read alignments that map to two exons separated by an intron? How do I extract this information from the Tophat output?

tophat exon bam • 1.8k views
ADD COMMENTlink modified 4.3 years ago by Biostar ♦♦ 20 • written 5.0 years ago by hbw70
1
gravatar for Sean Davis
5.0 years ago by
Sean Davis25k
National Institutes of Health, Bethesda, MD
Sean Davis25k wrote:

You are looking for reads that have the "N" operation in the samtools CIGAR column. See the SAM specification for details.

ADD COMMENTlink written 5.0 years ago by Sean Davis25k
1
gravatar for Charles Warden
5.0 years ago by
Charles Warden6.1k
Duarte, CA
Charles Warden6.1k wrote:

Have you checked the junctions.bed output file?

I think this should contain the sort of statistics that you are looking for (counts for reads supporting a given exon junction)

ADD COMMENTlink written 5.0 years ago by Charles Warden6.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2149 users visited in the last hour