Question: Finding Reads Joining Exons From Tophat Output
gravatar for hbw
6.8 years ago by
United States
hbw70 wrote:

I did an alignment with tophat, supplying the GFF file for gene annotations, and the chromosomes fasta (in bowtie2 index format). I converted the output accepted_hits.bam to sam. In the SAM header, it is listing all the chromosomes, and the reads are mapped to the chromosmes, like this:

266GRCF1GCCAAT:1:1101:8591:43171        0 NC_000076.6   38894021        50      49M     *       0       0       GGCGGGGGGAGGGTATCATGGACTTTTGGGATAGCATTTGAAATATAAA      @@@DDDDDB6BBB+8>CDDCCCCCCCCCBB?ACCCCECCCCCCACCCDE AS:i:0 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:49 YT:Z:UU NH:i:1
266GRCF1GCCAAT:1:2211:7290:90876        0 NC_000076.6   38894073        50      49M     *       0       0       AGAAAATATGTTAAAAATGTTTTGGAAAAAAGAAAAAAAGAAAATTGCC      CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJ AS:i:0 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:49 YT:Z:UU NH:i:1
266GRCF1GCCAAT:1:2202:7215:55833        0 NC_000076.6   38894074        50      49M     *       0       0       GAAAATATGTTAAAAATGTTTTGGAAAAAAGAAAAAAAGAAAATTGCCA      @CCFFFFFHHHHHJJJJIGIJJJIJJIIIIGIIIIGGEGHJIJIEGHII AS:i:0 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:49 YT:Z:UU NH:i:1

Where are the read alignments that map to two exons separated by an intron? How do I extract this information from the Tophat output?

tophat exon bam • 2.3k views
ADD COMMENTlink modified 6.1 years ago by Biostar ♦♦ 20 • written 6.8 years ago by hbw70
gravatar for Sean Davis
6.8 years ago by
Sean Davis26k
National Institutes of Health, Bethesda, MD
Sean Davis26k wrote:

You are looking for reads that have the "N" operation in the samtools CIGAR column. See the SAM specification for details.

ADD COMMENTlink written 6.8 years ago by Sean Davis26k
gravatar for Charles Warden
6.8 years ago by
Charles Warden7.9k
Duarte, CA
Charles Warden7.9k wrote:

Have you checked the junctions.bed output file?

I think this should contain the sort of statistics that you are looking for (counts for reads supporting a given exon junction)

ADD COMMENTlink written 6.8 years ago by Charles Warden7.9k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 941 users visited in the last hour