Trimming customed adaptor sequences with trimmomatic
1
0
Entering edit mode
4 weeks ago
1215045934 ▴ 30

Hello everyone!

Is it possible to trim the customed adaptors using trimmomatic for exon capture sequencing? If so, how can I create the adaptor fasta file (sequence header etc.)?

The adapters used are below, "BCBCBCBC" stands for the barcodes.

i7: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-BCBCBCBC-ATCTCGTATGCCGTCTTCTGCTTG

i5: AATGATACGGCGACCACCGAGATCTACAC-BCBCBCBC-ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Thank you in advance!

trim exon Bioinformatics trimmomatic illumina • 600 views
ADD COMMENT
0
Entering edit mode
4 weeks ago
GenoMax 100k

Are you sure these are truly custom adapters? Generally one looks for the core sequence at the beginning of adapter and then once that is found removes everything to the right of that sequence, which will include BCBCBCBC.

You can use bbduk.sh from BBMap suite with whatever adapters you want to use in a multi-fasta file like bbduk.sh in=your.fq out=clean.fq ref=adapter.fa ..... A guide is available.

ADD COMMENT
0
Entering edit mode

Thanks a lot! What is the core sequence you mentioned? I checked the universal adapter sequence file in trimmomatic. I do find the similar sequence to i5 adapter from TruSeq2-PE.fa, Primer1 but not anything similar to i7 adapter. Does that mean trimmomatic will remove the i5 adapter but not i7?

ADD REPLY
1
Entering edit mode

Here is an example of TrueSeq adapter sequences (from adapters.fa file in resources directory from BBMap suite)

>TruSeq_Adapter_Index_2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_3
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
>TruSeq_Adapter_Index_4
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG

GATCGGAAGAGCACACGTCTGAACTCCAGTC *ACATCACG* ATCTCGTATGCCGTCTTCTGCTTG
GATCGGAAGAGCACACGTCTGAACTCCAGTC *ACCGATGT* ATCTCGTATGCCGTCTTCTGCTTG
GATCGGAAGAGCACACGTCTGAACTCCAGTC *ACTTAGGC* ATCTCGTATGCCGTCTTCTGCTTG
GATCGGAAGAGCACACGTCTGAACTCCAGTC *ACTGACCA* ATCTCGTATGCCGTCTTCTGCTTG

So you can see that the differences are the indexes (or barcodes, I have separated them out and added a * to delimit) while the core sequences on either side are identical and match the i7 sequence you have.

ADD REPLY
0
Entering edit mode

Thank you so much! Is it possible to trim them in trimmomatic? It seems that the i7 sequence is not in the build-in adapter sequence in trimmomatic

ADD REPLY
0
Entering edit mode

Check other TruSeq*.fa files in Trimmomatic.

ADD REPLY
0
Entering edit mode

Yes I did check all the TruSeq-*-PE files in Trimmomatic but I did not find the i7 sequence.

ADD REPLY
0
Entering edit mode

You could use adapters.fa file from BBMap suite or simply use bbduk.sh :-)

ADD REPLY
0
Entering edit mode

Thank you so much! I will try it!

ADD REPLY
0
Entering edit mode

I did QC after trimming with both trimmomatic and bbduk.sh but there is still some Illumnina Universal Adapter left. Would you mind giving me some suggestions?

ADD REPLY
0
Entering edit mode

What is the exact command you used with bbduk.sh?

ADD REPLY

Login before adding your answer.

Traffic: 1661 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6