Hi all,
I'd like to know whether there are any tools to filter out only reads with a single SNV/mutation.
In detail, I generated a randomly mutated library of a protein-coding gene, screened non-functional variants, and then sequenced their CDS region. Unfortunately, many of the reads have multiple mutations at once so it's hard for me to find which mutation is critical for the loss-of-function. So I'd like to use reads only with a single mutation/SNV compared to the reference sequence for my variant calling.
For example,
reference: actgggtacccattgactagataccgta
read 1: actgggtCcccattgactagataccgta <- read I want to get (read with a single mutation)
read 2: actgggtacGcattgactaTataccgta <- read I don't want to use (read with more than one mutation)
I'd appreciate it a lot if you give me any advice on this. Thank you!
Hi, thank you for your answer. But I can't find any command '-e' in samtools view (http://www.htslib.org/doc/1.11/samtools-view.html)..
Oh, I found the command:
$13: NM
Thanks for your advice, Pierre!!
sunhyunchang : You need to upgrade to latest version of
samtoolswhich is1.12as of today. This version introduced the option that @Pierre mentions above.