How to solve Warning: [blastx] Taxonomy name
1
0
Entering edit mode
8 weeks ago

I am running blastX with the following:

blastx -db nr -remote -max_target_seqs 10 -outfmt  '6 sskingdoms' -query temp.fa

where temp.fa is the file (actually, more a txt than fa since I did not include the header) with the sequence, for instance:

ACGAAACCTATAGAGGATATTGGAATCGTCGTGTTGGATAACAAGCAGATAACTATCACTTCCGGTGTGCTGGAGGCTTTGCTTGAGAACAACTGTTCCGT

I get the warning

Warning: [blastx] Taxonomy name lookup from taxid requires installation of taxdb database with ftp://ftp.ncbi.nlm.nih.gov/blast/db/taxdb.tar.gz

But I also preceded the analysis with

export BLASTDB="~/blast/bin"

where the taxdb.btd and taxdb.bti are present.

How can I sort this error?

alignment blastx warning blast • 85 views
ADD COMMENT
0
Entering edit mode
8 weeks ago
GenoMax 102k

You can't combine -remote searches with local blast. Do one or the other.

ADD COMMENT

Login before adding your answer.

Traffic: 1128 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6