Very low alignment rate for miRNAs reads against known miRNAs from mirbase
0
0
Entering edit mode
3 days ago
LynxLynx • 0

*Hi all! I know that there are some similar topics and I read them but it didn’t solve my issue…

I’m working with smRNA-seq data (plants) and my aim is to find novel and known miRNAs, then perform DE expression analysis and find some correlations between miRNA and mRNA expression profiles.

I preprocced smRNA reads: 1) trimmed adapters using Illumina documentation I found only one adapter sequence actually and removed it with cutadapt. Command:

~/.local/bin/cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o trimmed.fq.gz in.fq.gz

98.5% reads with adapters, 41,2% total written

2) then I filtered tRNA and rRNA contamination using bbduk.sh

3) kept reads that are from 19 to 26 nt using cutadapt

Original reads: 17 483 425 sequences Clean reads: 6 592 972 sequences clean reads length distribution

And here is the issue. I aligned my clean reads against precursor miRNA sequences downloaded from mirbase to identify known miRNAs. I used both bowtie and bbduk.sh but alignment rate is very low, about 5%. What could cause it?

smRNA • 109 views
ADD COMMENT
0
Entering edit mode

Did you replace the U bases with T (e.g. sed 's/U/T/g') in miRBase sequences that you downloaded before doing the alignments?

ADD REPLY
0
Entering edit mode

My hairpin file doesn't contain U bases at all

Thank you

ADD REPLY
0
Entering edit mode

Great. I am not sure what kit was used for your dataset but some kits directly ligate a special adapter to miRNA. So unless that adapter is present the read likely does not represent a miRNA. Checking to see if this applies in your case.

ADD REPLY
0
Entering edit mode

can you show us some of the putative miRNAs that did not map?

ADD REPLY

Login before adding your answer.

Traffic: 1719 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6