Calculates the percent sequenceCalculates the percent sequence identity for a pairwise sequence alignment
0
0
Entering edit mode
3 months ago
Nalid • 0

Hello! How can i calculate the percentage identity between a pair of sequences?

Tem1_SRR6260399.808938_1_250_- TTGATTTGGCATATGTGGACAATAAGACGACAAATGATTATCAGATTATTCGGGTTCCAGCTCTTGTTTAATTTTACATGGAGCATTTTCTTCTTTTATCTCCGGAGTCCGTTGCTAGGTTTTGCAAACATTTTGGTGCTGGATGTGCTTGTTGTTTATTATATGATAGAAAGTTATCCGGTGAAGAAATCTTCGGCATACCTTTTTGTTCCTTATCTTTTGTGGTTGATTCTTGCCACTTATCTTAAC Tem5_SRR6260399.418888_1_220_+ CTCCTTATGAAAAAAATAATCCCCATACTGATTGCCATACTCATCTGTTTTGGTGTAGGCTGTACTGCTTCTTATTTTCAGTCGGAGGCCATACTCAACTGGTATCCTACATTGGACAAACCTTCTCTTACACCACCTGATATGGCTTTTCCCATTGCTTGGAGCCTTATCTATCTGTGCATGGGAATTTCTCTCGGGTTGATTTGGCATATGTGG

alignment a pairwise for identity sequence • 345 views
ADD COMMENT
0
Entering edit mode

Is this homework? (Do be honest, and the community will help.)

What have you tried already? Have the sequences been aligned? Are these the only sequences you need to deal with, or are there more?

ADD REPLY
0
Entering edit mode

I have 14 sequences that correspond to the TSPO protein found by HMM in a control condition. So I aligned them with Clustal and I saw that they align perfectly in the middle. The question is to know if it is the same protein. so I want to calculate the percentage of identity

ADD REPLY
1
Entering edit mode

Are you using Clustal-Omega? If yes, you can supply --distmat-out=<somefilename> and --percent-id to it on the command line (along with --full), and it will output a pairwise distance matrix that reports percent identity. So something like this:

clustalo --full --percent-id --distmat-out=test_distmat.txt -o test_out.msa -i test.fa
ADD REPLY

Login before adding your answer.

Traffic: 1855 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6