plant viruses sequences
1
0
Entering edit mode
11 weeks ago
Ric ▴ 360

Hi, Where could I download all plant viruses sequences?

Best wishes,

Michal

alignment gene • 355 views
ADD COMMENT
2
Entering edit mode
11 weeks ago
GenoMax 107k

Viral genomes browser is available from NCBI. Use filter by host (land plants seems to generate plenty of results). There is a Download button to the extreme right that is easy to miss. Download all accessions from there and then the actual data using EntrezDirect.

There is a new genome browser available here.

ADD COMMENT
0
Entering edit mode

Thank you, I click the Download bottom from your first link, selected land plants and downloaded the following files:

$ ls -hlatr
total 28M
-rw-rw-r-- 1 ubuntu ubuntu  30K Jul 28 12:19 taxid10239.acc_lst
drwxr-xr-x 5 ubuntu ubuntu 4.0K Jul 28 12:19 ..
-rw-rw-r-- 1 ubuntu ubuntu 323K Jul 28 12:19 taxid10239.tbl
-rw-rw-r-- 1 ubuntu ubuntu  28M Jul 28 12:19 taxid10239.nbr

However, I there a way to get the actual sequences? Thank you in advance,

Best wishes,

ADD REPLY
0
Entering edit mode

You can use Entrezdirect with a file containing list of NCBI accessions. Sequences below truncated for space.

$ more id.txt
NC_021708
NC_019498
NC_019944

$ cat id.txt | epost -db nuccore -format acc | efetch -format fasta

>NC_021708.1 Cuban alphasatellite 1 complete sequence, isolate 1_1
ACCCCGCCTCGTGCCATCTCTCCGTGCCATTGACTGGTCAATGGCTGTGGGTTTTTAAGGGCGTGCCGTC
CTGTGCCTTTATAAACCAGATAAATGGCAAAGTCTCGCAACTATTGCTTTACTCTATTCTCTTACGTCCT

>NC_019944.1 Okra enation leaf curl alphasatellite, complete sequence
AAGCTTTGGCCCCTGCGCACTTTAACCTTTGGCCCCTATAAATATATTTGTGCTGAGGCCGGATCATAGT
ATTACCCGGCCTCAGCCCCCGCCCCCTTGGTTTTTTCTCTAAATTGCCCCTCTCTCTCTAACAAGCCTTT

>NC_019498.1 Dragonfly-associated alphasatellite isolate PR_NZ48_2009, complete sequence
ACCCGCTTCGTTCCGTTTCCTCCTTGTTCCGGTATTTAAGCCTCCGCTTCTTTCATTTCTGGCTTCCTTT
CATGGGTTCCTTTTCGTCTCCAAGAAGCCGCTGGTGGTGCTTTACGTTAAATTTCTCCGGCGACCCGCCG
ADD REPLY

Login before adding your answer.

Traffic: 2027 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6