Identify Mapped reads and Unmaped Mate pairs
0
0
Entering edit mode
9 weeks ago
Umer • 0

Hey, I have a sorted bam file which i got by mapping with reference. I want to identify two things from this bam file.

  1. How many reads mapped to each gene/contig in my bam file.
  2. As this was paired-end data, i want to know how many genes/contigs just got a single read out of a pair mapped. like Forward read mapped to contig but reverse didn't.

I'm trying to find the answers using Pyhton library Pysam. My Bam file headers are

@HD VN:1.5 SO:coordinate @SQ SN:TRINITY_DN30590_c0_g2 LN:223 @SQ SN:TRINITY_DN30590_c0_g3 LN:331

and bam file looks like this.

HWI-1KL178:42:c39jdacxx:3:2308:16762:5814/1     16      TRINITY_DN30590_c0_g2   1       9       19S55M27S       *      0                                               0AGGTTTAATTGCAGAAGCTGAGCCTTTCATCTCCATCTTGGGGGTTTCCAGTTCTGCTAGCTGTGCCTCCAAAACACTGGCCTTACTGTATAATTCATCAG   FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIFIIFIIIIIIIFIIIIFFFFFFFFFFBBB   NM:i:0  ms:i:110        AS:i:110        nn:i:0  tp:A:P  cm:i:9  s1:i:46 s2:i:0 de:f:0                                          rl:i:0

I'm trying this Python code:

import pysam
file = pysam.AlignmentFile("AT165.bam", "rb")
for read in file.fetch():
        print(read)
file.close()

Any help will be great. Thank you.

ngs samtools mapping pysam • 286 views
ADD COMMENT
0
Entering edit mode

That's not paired end data.

ADD REPLY
0
Entering edit mode

i'm pretty sure i used both R1 and R2 for mapping part.

ADD REPLY
0
Entering edit mode

https://broadinstitute.github.io/picard/explain-flags.html

your read has flag 16. So the flag 1 (paired-end-data) is not checked, it's not paired-end data.

ADD REPLY

Login before adding your answer.

Traffic: 2846 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6