obtaining unique identifier for a sample from fastq files
0
0
Entering edit mode
11 months ago
Sara ▴ 200

in my fastq file which is named "8230-001-001_CTGATCGT-GCGCATAT_L004_R1.fastq.gz"

I am looking for the "unique identifier for a sample". here is the 1st few lines of the file:

@A00379:446:HGTTYDSX2:4:1101:1217:1094_GTGCCAAAGCAC 1:N:0:CTGATCGT+GCGCATAT
ATGTGGGCAAGGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATGGAACACGGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCTGAGGAGC
+
FF:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF,FFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFF:
@A00379:446:HGTTYDSX2:4:1101:11487:1094_ACGTTCAGCGTG 1:N:0:CTGATCGT+GCGCATAT
GGCGCTTGGCCTGTTCCATCTCCTCGTCCTTCTCTGCCAGCTTCCGCTCGATCTATGCCTTGATCTGGTTGAACTCTAGCTGGGCCCGGAGGATCTTGCCCTCCTCGTGCTCCAGGGAGGCCTGGGAAGGGGTGGGGTGAGGGC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:FFF,,FFFFFFFFFFFFFFFF

do you know how I can find "unique identifier for a sample"?

fastq • 562 views
ADD COMMENT
0
Entering edit mode

index (CTGATCGT+GCGCATAT) is unique to sample . Contact sequencing core for sample-index details.

ADD REPLY
0
Entering edit mode

Do you mean "unique to that sequencing run"? Or do you mean "universally unique"?

ADD REPLY
0
Entering edit mode

@swbarnes2 I mean unique identifier for each sample. example data is from one sample.

ADD REPLY
0
Entering edit mode

I still don't understand what you want. The barcode index will be unique for that sample in that lane, but obviously other samples run in other lanes/flowcells/instruments could have the same barcode. Or, this sample could be run in multiple lanes, or multiple instruments.

ADD REPLY

Login before adding your answer.

Traffic: 574 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6