Question: Bwa Mem Strange Id
1
gravatar for Nicolas Rosewick
5.0 years ago by
Belgium, Brussels
Nicolas Rosewick7.4k wrote:

Hi,

After using bwa mem to align paired-end data I've strange results in my data :

I've a sam entry with a strange read id :

<<F6@C8,,,;6,C<F<F<FGFFEDCE@CE@,<,,,@,6BF@F9B,,;,5,C?F    133    chr11    505    0    *    =    505    0        *    AS:i:0    XS:i:0

but this id is not in my R1.fastq and R2.fastq file ...

the command : bwa mem -t 5 -M -L 1 genome R1.fastq.gz R2.fastq.gz > out.sam with bwa 0.7.5a-r405

and here a subset of R1.fastq.gz reads

@M00991:61:000000000-A7EML:1:1101:15262:1043 1:N:0:16
GGCTCCTAGGTCGGCATGATCTTTCATACACAACCCACTCCAGTATACTGTCTCTTATCACATCTCCGAGCCCACG
+
BCC<ABF<CEGGEC::CFGGCFGDGGGGG@FGFECGGGEFGF@EF@FGDG,C@FEEEC@@FF<FEEF@FEGEGCG7
@M00991:61:000000000-A7EML:1:1101:19117:1047 1:N:0:16
GGCTCCTAGGTCGGCATGATCTTTCATACAAGAAATATCAATAGCACTGTCTCTTATACAATCTCCGAGCCCACGA
+
CCCCCGGGGGGGGGGGGGGGGGGGFFFFGFFEFCEFGDC@<E,6CCD8EFGGGFGFFGGGF9FEF,CCFGGGAFF:
@M00991:61:000000000-A7EML:1:1101:10229:1061 1:N:0:16
GGCTCCTAGGTCGGCATGATCTTTCATACAAATGACTCCCCCTCAAAAAAGGCGGGAGAGCCATTCATTTTCTAA

Anyone knows the solution ?

EDIT > Seems to be a problem with the fastq files.

Thanks

• 1.3k views
ADD COMMENTlink modified 5.0 years ago • written 5.0 years ago by Nicolas Rosewick7.4k
1

Please share the answer if you solved the problem, it may be helpful to someone in the future. It's not clear what the issue is with the fastq files (newlines maybe?).

ADD REPLYlink written 5.0 years ago by SES8.1k

what's the output of file R1.fastq.gz R2.fastq.gz and gunzip -c R1.fastq.gz|head ?

ADD REPLYlink written 5.0 years ago by Pierre Lindenbaum118k
0
gravatar for Nicolas Rosewick
5.0 years ago by
Belgium, Brussels
Nicolas Rosewick7.4k wrote:

I resolve the problem myself. It was a problem in the fastq files that I preprocessed before mapping. I "grep" a quality line unstead of an id...

ADD COMMENTlink written 5.0 years ago by Nicolas Rosewick7.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2534 users visited in the last hour