Comparing multiple columns from two files using AWK
1
0
Entering edit mode
5 months ago

Dear all,

I need your help to solve the following problem. I have the following two files (indicated as A and B):

FILE A:

head 129N.final-test_taxid-120686.txt
A00270:507:H3KTJDSX5:4:1105:31747:1736  1187    chr1    205559197   60  144M6S  =   205559203   152 GAGCATTTAGGCAAGAGAAAGGAACAAAGGGTATCCAAATTGAAAAACAGGAGTCAAATTGTCCCTTTGCAGACAACAGGATTTTACATATAGAAAAATCTAAAAGATCACACACACACACACACACACACACACACACACACACACAAA  FFFFFFFFFFFFFFF:FFFFFFFFFFF:FF:FFFF,FFFFF:FFFF:F:FFFFFF:F:FFFFFF:FFFFFF:FF,FFFFFFFFFFFFFFFFFFFFFF::,FFFF::,FFF,F:FFFFFFFFFFFFFFFF,FFFFFFFFFF:,F,FF,FF:  NM:i:0  AS:i:288    nn:i:0  tp:A:P  cm:i:18 s1:i:120    s2:i:0  de:f:0  rl:i:86 MQ:i:50 MC:Z:102M4I44M  ms:i:4398
A00270:507:H3KTJDSX5:4:1105:31747:1736  1107    chr1    205559203   50  102M4I44M   =   205559197   -152    TTAGTCAAGAGAAAGTAACAAATTGTATAAAAATTGAAAAACAGGAGTCAAATTGTCCCTTTGCAGACAACAGTATTTTACATATATAAAAATATAAAATATCACACACACACACACACACACACACACACACACACACACAAACCTCTT  ,FF:,,FF,F,:F:,,FF:,FF,,:,FFF,F:FF::FFFFF:F,F:::FFFFFFFF,::FF::,F,F:FFFFF,FF:FFF,FFFFF:FFFFF:,FF,FF,FF,FFFFFFFFFFFFFFFFFFF,FFFFFFFF:FFFFFFFFF:F,FFFFFF  NM:i:14 AS:i:176    nn:i:0  tp:A:P  cm:i:1  s1:i:120    s2:i:0  de:f:0.0748 rl:i:86 MQ:i:60 MC:Z:144M6S ms:i:5013
A00270:507:H3KTJDSX5:4:1338:10565:21731 1123    chr11   73519648    60  150M    =   73519687    191 AAAAGAACAGCATGAGCAAAGTCACTGAAGGAGAAAAAAGCTTGACAGGCTCTCAGAGGAGCTGAGAGATGATGAGGATAGCTGGAACACAGAGAACAAGGGAGAGAGCAGCACAAAGACCAGAGCATGTATGTGTGTGTGTGTGTGCGT  FFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF,FFFFFFF:F,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFF,F,F:FFFFFFFFFFFFFFFFFF  NM:i:0  AS:i:300    nn:i:0  tp:A:P  cm:i:20 s1:i:164    s2:i:0  de:f:0  rl:i:0  MQ:i:60 MC:Z:131M2D19M  ms:i:4508
A00270:507:H3KTJDSX5:4:1338:10565:21731 1171    chr11   73519687    60  131M2D19M   =   73519648    -191    GCTTGACAGGCTCTCAGATGAGCTGAGAGATGATGACGATAGCTGGAACACAGAGAACCAGGGAGAGAGCAGCACACAGACCAGAGCATGTCTGTGTGTGTGTGTGTGCGTGTGCGTTTGTGTGTGTATACATATATATGTATATTTTTT  F,:,::,F::FFFF,FF,,F,,F:FFFFF,FF:FF,,::,:FFF,:FFFF:FFF::F,,,F:FFFFFFFFFFFF,F,FFFFFFFF,F:F:F,FFFFFFFFFFFFFF:F:FFFFFFFFFFFFFFFF,FF,FFFFFFFFFFFFFFFFFFFFF  NM:i:7  AS:i:234    nn:i:0  tp:A:P  cm:i:5  s1:i:164    s2:i:0  de:f:0.0397 rl:i:0  MQ:i:60 MC:Z:150M   ms:i:5305

FILE B:

head 129C_129N_NA_NA-result.txt
"chr" "window_start" "window_end" "CpG_density" "gene body" "exon" "intron" "TSS" "TFBS" "CpG Island" "TvN_log2FC" "TvN_pvalue" "TvN_adjPval" "Normal_beta_means" "Tumor_beta_means"
"1" "chr1" 598225 598636 18.4427890754089 "" "" "" "" "" "" 4.3611988195503 1.3571329343012e-06 0.000213095969395564 NA NA
"2" "chr1" 798869 799280 1.94117546441723 "" "" "" "" "" "" 3.33729293030521 0.0028193049869542 0.00603736189514813 NA NA
"3" "chr1" 964493 964904 15.8745202346568 "" "" "" "" "" "" -4.03939052576444 9.65027705808557e-05 0.00139164913571352 NA NA
"4" "chr1" 1289973 1290384 13.2691422964244 "" "" "" "" "" "" 2.24668352741542 0.000147522985565905 0.00147072671202151 NA NA
"5" "chr1" 1452713 1453124 5.52888052862558 "" "" "" "" "" "" 3.2958343457078 0.00326925560284505 0.00654091448106587 NA NA
"6" "chr1" 1484025 1484436 9.01501605142477 "" "" "" "" "" "" -2.91774020058587 0.0012539611860937 0.0037948825368625 NA NA
"7" "chr1" 1543353 1543764 9.72593333917879 "" "" "" "" "" "" -4.58247376587071 8.67234633703419e-07 0.000157092251623494 NA NA
"8" "chr1" 1673545 1673956 6.58667962552194 "" "" "" "" "" "" -3.71387653352646 0.000659203327330426 0.00295087454366937 NA NA
"9" "chr1" 1882017 1882428 3.73642500628685 "" "" "" "" "" "" -3.9364144585912 0.00013094999836789 0.00139164913571352 NA NA

I need to execute the next loop to select the fields respecting the following conditions:

for every line in A do
    for every line in B do
        if ($3_A == $2_B)  ##belong to the same chr
            if ($3_B <= $4_A <= $4_B)  ##the read into the window
                print($3_A, $4_A)

I already tried some solution like that I report, but without the expected results:

awk 'FNR==NR{pimga_char[$3]; pimga_num[$4]; next}; ($2 in pimga_char) && ($3 < pimga_num) { print $1}' A.txt B.txt

Please, any kind of support will be appreciated!!!

Thank you
Emilio

awk • 491 views
ADD COMMENT
0
Entering edit mode

Switch to python or R,this will get a lot easier. Also, I've formatted your post so it looks better. Please invest some time yourself into formatting your posts so they are easier to read.

ADD REPLY
0
Entering edit mode

Thank you for the formatting support. Please, can you suggest the code (R/Python) to approach my problem? Something I can use as a starting example will be enough. Thank you

ADD REPLY
0
Entering edit mode

R's dplyr will serve well here.

fileA %>% mutate(V3 = sub(V3, "chr","") %>% inner_join(fileB, join_by(V3 == chr, window_end <= V4, ...
ADD REPLY
0
Entering edit mode
5 months ago

convert the first file to bed. something like:

awk -F '\t' '{printf("%s\t%d\t%s\t%s\n",$3,int($4)-1,$4,$0);}' 129N.final-test_taxid-120686.txt 

convert the second file to bed, something like, assuming a tsv FILE

cut -f 2- 129C_129N_NA_NA-result.txt | tr -d '"'

sort both files on chrom/chromStart and use bedtools intersect

ADD COMMENT

Login before adding your answer.

Traffic: 1675 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6