finding evidence(s) of a peptide translated from an "Upstream Open Reading Frame (uORF)"
1
1
Entering edit mode
5 weeks ago

Hi all,

( https://en.wikipedia.org/wiki/Upstream_open_reading_frame) An upstream open reading frame (uORF) is an open reading frame (ORF) within the 5' untranslated region (5'UTR) of an mRNA. uORFs can regulate eukaryotic gene expression.Translation of the uORF typically inhibits downstream expression of the primary ORF.

I wonder if there an easy way to find evidences that an uORF is actually translated. For example in : https://www.bioinformatics.uni-muenster.de/tools/uorfdb/download/index.hbi?lang=en there is:

>>> 279332
$1                   Taxon : Homo sapiens
$2                Assembly : hg38
$3                     Chr : chr10
$4                  Symbol : CREM
$5                  GeneID : 1390
$6               GenBankID : 
$7           SymbolAliases : CREM-2; ICER; hCREM-2
$8               GeneNames : cAMP responsive element modulator; cAMP-responsive element modulator; CREM 2alpha-b protein; CREM 2beta-a protein; cAMP response element modulator; inducible cAMP early repressor ICER
$9                  NCBIID : NM_001394623.1
$10           TranscrStart : 35126845
$11             TranscrEnd : 35212953
$12                 Strand : +
$13          TranscrLength : 2518
$14              TLSlength : 549
$15               CDSstart : 35188276
$16                 CDSend : 35211398
$17    TranscrKozakContext : TTAACAATGA
$18   TranscrKozakStrength : adequate
$19             ExonStarts : 35126845; 35148367; 35188199; 35206894; 35211253
$20               ExonEnds : 35127193; 35148491; 35188388; 35207051; 35212953
$21                uORF_ID : NM_001394623.1_GTG.7
$22              uORFstart : 35188214
$23                uORFend : 35188274
$24         uORFstartCodon : GTG
$25          uORFstopCodon : TAA
$26             uORFlength : 60
$27        uORFCDSdistance : 2
$28     uORF5'-capDistance : 487
$29       uORFkozakContext : CCCAAGGTGG
$30      uORFkozakStrength : strong
$31               uORFtype : non-overlapping
$32       uORFreadingFrame : 3
$33      uORFnucleotideSeq : GTGGAACAATCCAGATTTCTAACCCAGGATCTGATGGTGTTCAGGGACTGCAGGCATTAA
$34           uORFaminoSeq : MEQSRFLTQDLMVFRDCRH*
$35       SharedStartCodon : 
<<< 279332

here the uORF is translated to MEQSRFLTQDLMVFRDCRH.

is there any database where I can find that this peptide was found "in-vivo". I would search for something like a mass-spectrometry database, but I don't really know this field of research.

For example, I found: http://pepquery2.pepquery.org/

but I don't know what is the correct way of searching such sequence (dataset ? task type ? ...) or to interpret the output.

>>> 2
$1           peptide : MEQSRFLTQDLMVFRDCRH
$2      modification : Oxidation of M@12[15.9949];Carbamidomethylation of C@17[57.0215];TMT 10-plex of peptide N-term@0[229.1629]
$3                 n : 341
$4    spectrum_title : f06183_Prot_10_F06:24104:3
$5            charge : 3
$6          exp_mass : 2713.340475287064
$7           tol_ppm : -11.605709723058858
$8            tol_da : -0.03148987647364265
$9     isotope_error : 0
$10         pep_mass : 2713.30898541059
$11               mz : 905.4541015625
$12            score : 33.13133690871885
$13             n_db : 0
$14         total_db : 173
$15         n_random : 0
$16     total_random : 1000
$17           pvalue : 9.99000999000999e-4
$18             rank : 1
$19            n_ptm : 1
$20        confident : No
$21  ref_delta_score : 9.171662518568212
$22  mod_delta_score : -34.25203993290825
$23    mod_filtering : Removed
<<< 2

or is there any other method to find a peptide in a proteomic database ?

(cross-posted: https://github.com/bzhanglab/PepQuery/issues/63 )

UTR masspec uORF peptide • 512 views
ADD COMMENT
1
Entering edit mode
5 weeks ago
GenoMax 143k

Perhaps: https://www.ebi.ac.uk/pride/peptidome/

This site is very slow. Almost to the point of being not usable. My search with your peptide has taken 10+ min and counting with no result at the time of writing this comment.

ADD COMMENT
0
Entering edit mode

thanks.

looks interesting but it's broken. the Firefox console shows a 404 for https://www.ebi.ac.uk/pride/ws/archive/v2/peptidesummary?keyword=MEQSRFLTQDLMVFRDCRH&page=0&pageSize=20

ADD REPLY
1
Entering edit mode

There is an API that you could try: https://www.ebi.ac.uk/pride/markdownpage/prideutilities

ADD REPLY

Login before adding your answer.

Traffic: 1510 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6