Understand Samtools View Output
1
5
Entering edit mode
12.7 years ago
Zhshqzyc ▴ 520
samtools view BAMFILE chr2:1,000,000-2,000,000

Hi I use the above command to get an output but I don't understand the meaning.

6197WAAXX100111:2:80:17948:14261    163    chr21    38781704    99    101M    =    38782013    409    AAATACATATATTGAATATGTGGATAAAATCACTAGAATATATTCGTGCAATAACATCTACGTGAGACATGACAGCATCTCACCATGTCTGGCAGTCTCTC    ;=>==<???@@ABBCDCDDEDEFEEEFFFEDECEEEFFEEEEEED>EEEEFEEFDFCDFED<EEFEFCFEEEDFEFDBDCEFAEDDCC@BBAD@AA>A>?<    RG:Z:6197W.2    E2:Z:GGGGGAGGGGGGGTGGGGGTGTTGGGGGCGAGAGCAGTATGCGGATGTACTATCACGAGCAAGTGATATGTCAGAAGCAAACAAGGTAAGTTAGACAGAGA    OQ:Z:CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCDCCCCBCCCCCCCCCDCCCCB@CBCCBCDDBAABB@C>BBAAB>A    PG:Z:6197W.2    NM:i:0    UQ:i:0

There are so many columns. Thanks for help.

samtools • 41k views
ADD COMMENT
2
Entering edit mode
ADD REPLY
1
Entering edit mode

The link is broken for me.

ADD REPLY
0
Entering edit mode

My question is not for sam file's format. My question is that if I use the command samtools view -o output.txt bam region Then in the output file, there are many columns. I don't know the meaning. It is different the sam file's format.

ADD REPLY
0
Entering edit mode

I have the same question, did you figure this out? The output for using samtools view is different than the straight samtools format columns...

ADD REPLY
12
Entering edit mode
12.7 years ago
Rm 8.3k

Sam format: column information:

  1. QNAME: Query name of the read or the read pair
  2. FLAG: Bitwise flag (pairing, strand, mate strand, etc.)
  3. RNAME: Reference sequence name
  4. POS: 1-Based leftmost position of clipped alignment
  5. MAPQ: Mapping quality (Phred-scaled)
  6. CIGAR: Extended CIGAR string (operations: MIDNSHP)
  7. MRNM: Mate reference name (‘=’ if same as RNAME)
  8. MPOS: 1-based leftmost mate position
  9. ISIZE: Inferred insert size
  10. SEQQuery: Sequence on the same strand as the reference
  11. QUAL: Query quality (ASCII-33=Phred base quality)

FURTHER DETAILS OF SAM FORMAT: http://samtools.sourceforge.net/SAM1.pdf

ADD COMMENT

Login before adding your answer.

Traffic: 1331 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6