Question: BWA: improper orientation but listed as properly paired
1
gravatar for richard.deborja
5.5 years ago by
Canada
richard.deborja110 wrote:

I have a set of BAM files for a targeted sequencing experiment.  After reviewing things in IGV, I noticed that a pair of reads listed as orientation F2R1 are labelled as properly paired.  I also noticed another pair listed as F1R2 that were also labelled as properly paired.  From my understanding of paired-end sequencing, F1R2 is the correct orientation and F2R1 would be more consistent for mate-pair.  The version of BWA used was 0.6.2 and Picard 1.107 for post-processing (conversion to BAM, sorting, indexing, read group addition).  I confirmed alignment to the reference genome using BLAT and identified the reads in the original FASTQ files for read 1 and read 2.  Any idea why it would list both orientations as properly paired?

I'm including the SAM entries below with modified read IDS:

17091    163    chrX    48649459    60    151M    =    48649634    326    AAGGATTTCTGTGTCTGAGGACCCCTTCTGTCCTCGCAGGTTAATCCCCAGAGGCTCCAGGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGG    @CCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJJJJJHHHFFFFFECCEEDBBDDDDDDDDDDDDDDCDDDC@CDDDDDDDDDDDDDED?CBDDDDDCCCDDDDCDDDDDDDDDDDDDB?CADCCCD    X0:i:1    X1:i:0    MD:Z:59T91    RG:Z:8932118E-CCA7-11E3-9394-35788F63E160    XG:i:0    AM:i:37    NM:i:1    SM:i:37    XM:i:1    XO:i:0    XT:A:U
49588    99    chrX    48649459    60    151M    =    48649532    224    AAGGATTTCTGTGTCTGAGGACCCCTTCTGTCCTCGCAGGTTAATCCCCAGAGGCTCCAGGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGG    CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJJHHJJJJJHHHFFFFFFEDEEDDDDDBDDDDDDDDDDDDDDDDCCDDDDDDDDDBDDDEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBDDDDDDD8    X0:i:1    X1:i:0    MD:Z:59T91    RG:Z:8932118E-CCA7-11E3-9394-35788F63E160    XG:i:0    AM:i:37    NM:i:1    SM:i:37    XM:i:1    XO:i:0    XT:A:U
49588    147    chrX    48649532    60    151M    =    48649459    -224    CTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGGTTTTCTTCCCCTCTGGGCCTGAGGGCTTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTG    DDDDDDDDDDDDDDCCDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBADDDDDDDDDDDDCADEDEDDDDDDDDDDDDDDDDDDDDDDDDFFFFHHHHJJIJJJJJJJJJJJJIJJJJJJJIIJJJJJJJJJJJHHHHHFFFFFCCC    X0:i:1    X1:i:0    MD:Z:151    RG:Z:8932118E-CCA7-11E3-9394-35788F63E160    XG:i:0    AM:i:37    NM:i:0    SM:i:37    XM:i:0    XO:i:0    XT:A:U
17091    83    chrX    48649634    60    151M    =    48649459    -326    GGCTTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTGCAGCTGCGGCACTGGCCTACTACAGGGACGCTGAGGCCTACAGACACTCCCCAGGTAACTCCATTGAGTGGCTGTCTTGGCATTGGCTGAGTGCTGTTGGGG    8DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBDDDDDDDDDDDDDDDDDDDDDDEFEDDDDDDDDDDEFFFFFHHHHHHJIIHHJJIJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHHHFFFFFCCC    X0:i:1    X1:i:0    MD:Z:151    RG:Z:8932118E-CCA7-11E3-9394-35788F63E160    XG:i:0    AM:i:37    NM:i:0    SM:i:37    XM:i:0    XO:i:0    XT:A:U

 

bwa bwa aligner pairedend • 4.6k views
ADD COMMENTlink modified 5.5 years ago by Devon Ryan93k • written 5.5 years ago by richard.deborja110

Hello richard.deborja!

It appears that your post has been cross-posted to another site: http://seqanswers.com/forums/showthread.php?t=44081

This is typically not recommended as it runs the risk of annoying people in both communities.

ADD REPLYlink written 5.5 years ago by Pierre Lindenbaum124k

Hello richard.deborja!

It appears that your post has been cross-posted to another site: Apparently cross posting is a bad idea, since I'm unable to delete/close the seqanswers post, closing this thread.

This is typically not recommended as it runs the risk of annoying people in both communities.

ADD REPLYlink written 5.5 years ago by richard.deborja110

don't close the thread. That's ok. But in the future avoid to post on both sites within a short period or without linking to the cross-posts.

ADD REPLYlink written 5.5 years ago by Pierre Lindenbaum124k
2
gravatar for Devon Ryan
5.5 years ago by
Devon Ryan93k
Freiburg, Germany
Devon Ryan93k wrote:

The reads are indeed properly paired. In one case you have:

read1---->
             <---read2

and in the other

read2---->
             <---read1

In both cases, the reads are pointing toward each other, meaning that they're in the appropriate orientation.

ADD COMMENTlink written 5.5 years ago by Devon Ryan93k

If sequencing is done 5' to 3', wouldn't the orientation be:

<--- read1

                  read2--->

ADD REPLYlink written 5.5 years ago by richard.deborja110

In the cases where read1 is reverse complemented, it's 3' of read2.

ADD REPLYlink modified 5.5 years ago • written 5.5 years ago by Devon Ryan93k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2380 users visited in the last hour