Question: some problem with my RRBS data when dealt with bismark
1
gravatar for hua.peng1314
5.7 years ago by
hua.peng1314100
China
hua.peng1314100 wrote:

Hi,I have deal with my RRBS data,but the result is strange.

if I use these mands:

/usr/local/bin/trim_galore  --phred33 -q 10 --length 35  -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --paired RRBS_R1.fastq RRBS_R2.fastq --retain_unpaired --keep --output_dir .

~/software/bismark_v0.11.1/bismark -q -n 1 -l 40 ~/projects/Methylation/BS_seq/reference1/ -1 RRBS_R1_val_1.fq -2 RRBS_R2_val_2.fq

The result is :

Sequence pairs analysed in total:       12619146
Number of paired-end alignments with a unique best hit: 9550086
Mapping efficiency:     75.7% 
Sequence pairs with no alignments under any condition:  2683530
Sequence pairs did not map uniquely:    385530
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

if I use these commonds :

/usr/local/bin/trim_galore  --phred33 -q 10 --length 35  -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --paired RRBS_R1.fastq RRBS_R2.fastq --retain_unpaired --keep --output_dir .
/usr/local/fastx/fastq_quality_trimmer -i RRBS_R1_val_1.fq -t 20 -l 20 -o RRBS_R1_val_QC_1.fq -Q 33
/usr/local/fastx/fastq_quality_trimmer -i RRBS_R2_val_2.fq -t 20 -l 20 -o RRBS_R2_val_QC_2.fq -Q 33

~/software/bismark_v0.11.1/bismark -q -n 1 -l 40 ~/projects/Methylation/BS_seq/reference1/ -1 RRBS_R1_val_QC_1.fq -2 RRBS_R2_val_QC_2.fq

The result is

Sequence pairs analysed in total:       12619144
Number of paired-end alignments with a unique best hit: 2646896
Mapping efficiency:     21.0% 
Sequence pairs with no alignments under any condition:  9865457
Sequence pairs did not map uniquely:    106791
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

If I use these commands:

/usr/local/fastx/fastq_quality_trimmer -i RRBS_R1.fastq -t 20 -l 20 -o RRBS_R1_QC_1.fq -Q 33
/usr/local/fastx/fastq_quality_trimmer -i RRBS_R2.fastq -t 20 -l 20 -o RRBS_R2_QC_2.fq -Q 33
/usr/local/bin/trim_galore  --phred33 -q 10 --length 35  -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --paired RRBS_R1_QC_1.fq RRBS_R2_QC_2.fq --retain_unpaired --keep --output_dir .
~/software/bismark_v0.11.1/bismark -q -n 1 -l 40 ~/projects/Methylation/BS_seq/reference1/ -1 RRBS_R1_QC_1_val_1.fq -2 RRBS_R2_QC_2_val_2.fq

The result is

Sequence pairs analysed in total:       12610256
Number of paired-end alignments with a unique best hit: 592
Mapping efficiency:     0.0% 
Sequence pairs with no alignments under any condition:  12609412
Sequence pairs did not map uniquely:    252
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

 

The significant difference confused me.Appreciate for your help.

rrbs • 2.3k views
ADD COMMENTlink modified 5.7 years ago by Devon Ryan94k • written 5.7 years ago by hua.peng1314100
3
gravatar for Devon Ryan
5.7 years ago by
Devon Ryan94k
Freiburg, Germany
Devon Ryan94k wrote:

NEVER USE FASTX TOOLS FOR PAIRED-END FILES!!!

fastq_quality_trimmer is making your paired-end files out of sync, which will make the results complete crap. trim_galore does a good job, there is no reason to use any trimmer after it for RRBS data.

ADD COMMENTlink modified 5.7 years ago • written 5.7 years ago by Devon Ryan94k
1
Hey Devon, How should I do if I want to merge read1 and read2 and then take them as the single end of sequencing data and then do the adaptor trim and alignment? 
ADD REPLYlink modified 4.3 years ago • written 4.3 years ago by Shicheng Guo8.1k

Hmm, are these still RRBS reads as in the original post? You could either trim and then merge or merge and then trim, though I have a sneaking suspicion that the former will work slightly better (this will obviously depend on the read length and fragment length).

ADD REPLYlink written 4.3 years ago by Devon Ryan94k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1451 users visited in the last hour