Question: RNAduplex sequence input format
0
gravatar for ete
6.3 years ago by
ete100
Germany
ete100 wrote:

Hello!

I am using RNAduplex  from Vienna package and trying to find out in which format the two sequences has to be passed to the cmd. The manual only say "reads two RNA sequences from stdin or <filename>". I used a filename but this might lead to IOErrors if my query sequence is very long. Does anybody know how to give the two sequences?

 

Thanks in advance!

rna-seq • 1.7k views
ADD COMMENTlink modified 6.3 years ago • written 6.3 years ago by ete100

Hello Asaf!

I want to start RNAduplex from a cmd in a Python script by entering the sequence directly (not a file). 

I tried already but without success:

'RNAduplex ATG GTC'

'RNAduplex ATG\nGTC'

Thanks

ADD REPLYlink written 6.3 years ago by ete100

echo "AGCT\nACGT\n" | RNAduplex

or I can send you a script that open a process, write sequences to the process and read the results, works with threading as well if you have a lot of sequences

ADD REPLYlink written 6.3 years ago by Asaf8.4k

Sorry, Asaf I am still having problems:

In Python I do something like this:

cmd = 'RNAduplex < duplex.seq'

p = subprocess.Popen(cmd,shell=True,stdout=subprocess.PIPE)

 

But I want to give the raw sequences as paramters. I tried something like:

cmd = "AGCT\nACGT\n" RNAduplex

but it does not work. Any hints?

ADD REPLYlink written 6.3 years ago by ete100

cmd = 'echo "AGCT\nACGT\n" | RNAduplex'

<font color="#666666" face="Helvetica Neue, Helvetica, Arial, sans-serif">you can either have stdin=subprocess.PIPE and have:</font>
<font color="#666666" face="Helvetica Neue, Helvetica, Arial, sans-serif">p.stdin.write("ACGACT\nACGAGCTG\n")</font>
<font color="#666666" face="Helvetica Neue, Helvetica, Arial, sans-serif">print p.stdout.next()</font>
 
ADD REPLYlink written 6.3 years ago by Asaf8.4k
2
gravatar for Asaf
6.3 years ago by
Asaf8.4k
Israel
Asaf8.4k wrote:

You should give two sequences with or without the headers (>seq1...)

e.g.

$RNAduplex 

Input two sequences (one line each); @ to quit
....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8
AGCGAGCTGTGTGACTGTGACTGATGCTG
ACGAGCTGATGCTGATCTATGCGTATGCTGATGC
lengths = 29,34
((((.((.(((((((.(((.(....(((.&.))).).))).).)).)))))).)))).   1,29  :   3,30  (-10.00)

If your sequences are in a file you should execute:

$RNAduplex < input_file

each pair of RNA sequences will be evaluated for their binding.

ADD COMMENTlink written 6.3 years ago by Asaf8.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1033 users visited in the last hour