Question: SAM file output
0
gravatar for AW
4.0 years ago by
AW350
United Kingdom
AW350 wrote:

I would be very grateful if someone could answer my question about sam files. I have mapped paired end reads so they must both map concordantly using Bowtie. 

However, when I look at the sam output file, even though I see that all reads have mapped concordantly (YT:Z:CP) it varies whether the alignment for both reads is reported or only one pair is reported. This is illustrated in the example below where only the alignment for one read of HISEQ2500-09:128:H9FFTADXX:2:1102:13154:48635 is shown but both are reported for HISEQ2500-09:92:H8PJKADXX:1:1214:1438:92949.

What is causing this??

Thanks.

grep "scaffold100060" output.sam

HISEQ2500-09:92:H8PJKADXX:1:1214:1438:92949    83    scaffold100060    208    42    100M    =    19    -289    GGATTTTAAAGCCACTCTAAGTCACTTTTTCTGGCATAAAAAACTCCAACAAATAACTGGTCAAGAAATTTGTAATCACTTTTATAAATTAGTCCAACAG    DDEDDDDDDDDDEEEEEDFFFFEHHHHIIIJJJIIJJIJJJIHJJJJIIJJJJIJIJJJJJJJJJJJHHCJJIIHHFEJJJJJJIJJHHHHHFFFFFCCC    AS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:100    YS:i:0    YT:Z:CP
HISEQ2500-09:92:H8PJKADXX:1:1214:1438:92949    163    scaffold100060    19    42    100M    =    208    289    AATTAATCTGCTTTGGACTGAAAAGAACTTCAGTCAGCATAATGCGGCTGGATGCAACATAATTTCCAGATTTAAAGTATCTACTAAAGTTTTAACAATC    BBBFFFFFHHHHHJJJJIIJJJJJIGJJJJIHJJJJJJJJJJJJIJJJJJJGIIJJJJIJJJIJJHHHHGHHFFFFFFFFEEECEDEDDEDEDDDDDDDD    AS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:100    YS:i:0    YT:Z:CP
HISEQ2500-09:128:H9FFTADXX:2:1102:13154:48635    99    scaffold100060    60    40    100M    =    260    306    ATGCGGCTGGATGCAACATAATTTCCAGATTTAAAGTATCTACTAAAGTTTTAACAATCCCATGTAAAGCACCTAATTTACTGAATTGTAAATTAATTGT    ??@DD:?D?<#22ABFFGFFEBFGIEFEGFFIIFEG:BGFIEFECFCF?B@FECFGCFEIFIFI@DFIBEEFEDDDDDDDAAAABBB>@DDB@BB@>>@;    AS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:100    YS:i:-34    YT:Z:CP
HISEQ2500-09:128:H9FFTADXX:2:2212:6463:28248    99    scaffold100060    55    23    100M    =    350    387    GCATAATGCGGCTGGATGCAACATAATTTCCAGATTTAAAGTATCTACTAAAGTTTTAACAATCCCATGTAAAGCACCTAATTTACTGAATTGTAAATTA    CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJGHJJJJJJJJJJJJJJJJJJJIJJJJIJHHHHHHHFFFFFEEEDEEEDDDEDDEEFFED    AS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:100    YS:i:-55    YT:Z:CP
sam dna-seq bowtie2 • 1.5k views
ADD COMMENTlink modified 3.0 years ago by Biostar ♦♦ 20 • written 4.0 years ago by AW350

Do you have more than 4 alignments output by grep? You're correct that the mates should all be there in each of those cases. If they're not, then that's a bug in the aligner.

ADD REPLYlink written 4.0 years ago by Devon Ryan88k

Hi,

Thanks for your help! I had a few more alignments output by grep but they just showed the same pattern. Im using Bowtie 2 version 2.2.4. Have you come across this problem before?

 

ADD REPLYlink written 4.0 years ago by AW350

Not that I've seen, but I honestly haven't explicitly checked. One of my programs uses bowtie2 internally, so I'll add a check for this. Can you post the exact command that you ran, just in case there's some odd combination of options needed to cause this behavior?

ADD REPLYlink written 4.0 years ago by Devon Ryan88k

make sure to be grepping for the read name and not scaffold name, the alignments could still be there perhaps are just not reported consecutively

ADD REPLYlink written 4.0 years ago by Istvan Albert ♦♦ 79k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 713 users visited in the last hour