How to calculate pairwise ts/tv ratio given a alignment
0
0
Entering edit mode
6.0 years ago
YMTIO • 0

Hi Everyone

Could anyone tell me how to calculate pairwise ts/tv ratio given a alignment (the 4-fold degenerate sites extracted from a CDS alignment)? which software or script can do this?

 

One example for the alignment (fasta) is like:

>taxa001
TATATATTTTTTTTAAAAATAATAATATTA
>taxa002
TATATATTCTTACTAAAAATAATAATATTA
>taxa003
TATATATTCTTACTAAAAATAATAATATTA
>taxa004
TATATATTCTTACTAAAAATAATAATATTA
>taxa005
TATATATTTTTTTTAAAAATAATAATATTA
>taxa006
TATATATTCTTACTAAAAATAATAATATTA

alignment substitution software • 1.9k views
ADD COMMENT
1
Entering edit mode

Can you define what you mean by "alignments?" Typically for NGS data you're going to pull ts/tv from the variant (VCF) data.

ADD REPLY
0
Entering edit mode

The alignment is  the 4-fold degenerate sites extracted from a CDS alignment

ADD REPLY
0
Entering edit mode

show us a sample please.

ADD REPLY
0
Entering edit mode

The alignment (fasta) is like:

>taxa001
TATATATTTTTTTTAAAAATAATAATATTA
>taxa002
TATATATTCTTACTAAAAATAATAATATTA
>taxa003
TATATATTCTTACTAAAAATAATAATATTA
>taxa004
TATATATTCTTACTAAAAATAATAATATTA
>taxa005
TATATATTTTTTTTAAAAATAATAATATTA
>taxa006
TATATATTCTTACTAAAAATAATAATATTA

ADD REPLY

Login before adding your answer.

Traffic: 2376 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6