Question: BLAST options error: tried to set option (130) and value (1), line (537)
0
gravatar for oliver.bayfield
4.3 years ago by
United States
oliver.bayfield130 wrote:

I'm running local blast/2.2.30+ (on a server), command blastx (-task blastx-fast) against the nr database, with a query file of about 2000 fasta nt sequences of the form:

     >12345678:1200-1400_+

     ACGTACGTACGTAGCTAGCTAGCTGACTGACTG

where the first number refers to genome gi, followed by start, stop, and strand

The command I'm running is:

     blastx –task blastx-fast -query filein.fa -db /../../../fdb/blastdb/nr -out fileout.fa -outfmt 11 -num_threads 24 -max_target_seqs 1 –max_hsps 1 -matrix BLOSUM62 -qcov_hsp_perc 95 –strand both


If I awk line 537 from my input file (as the error refers to a line 537) I get the following - nothing unusual (lines 536 and 538 are nucleotides like this):

     $ awk '{ if (NR==537) print $0 }' file.fa

     CCCTGAATTAGCAGTTAAACCATTCTTCCAATTAGCATATGACATTAATACACACCGTGGTTACTTCCGAATTTCACGTG

blast local blast fasta • 1.9k views
ADD COMMENTlink modified 3.7 years ago by susan.klein50 • written 4.3 years ago by oliver.bayfield130
0
gravatar for h.mon
4.3 years ago by
h.mon27k
Brazil
h.mon27k wrote:

It is not an hyphen at "–task" and this is messing the the parsing of the command-line. This is a common error, it happened to me when copying examples from the internet (the unicode encoding is messed somehow, and what you copy is not what you see), and if you look around here you will find several posts where the problem was ultimatelly the same, e.g. Help with custom database of a genera and count of hits (NGS, 454) and Indexing reference genome for GATK.

I believe the "line 537" refers to BLAST sources, not your input file.

ADD COMMENTlink written 4.3 years ago by h.mon27k

Unfortunately this doesn't solve it. Usually you get a 'didn't recognise flag' type error when you copy the wrong hyphen in also.

ADD REPLYlink modified 4.3 years ago • written 4.3 years ago by oliver.bayfield130

Did you correct the other instances (–max_hsps and –strand)?

ADD REPLYlink written 4.3 years ago by h.mon27k
0
gravatar for oliver.bayfield
4.3 years ago by
United States
oliver.bayfield130 wrote:

(Re. to above comment)
Yes, when I copy something in I correct them all as a matter of course.
It seems to be related with output format 11. Output format 6 for instance does at least begin running (although later fails with 'Segmentation fault'?). Thanks

ADD COMMENTlink modified 4.3 years ago • written 4.3 years ago by oliver.bayfield130

You may try a binary search on your input file, spliting it in halves until you find the offending sequence.

ADD REPLYlink written 4.3 years ago by h.mon27k
0
gravatar for susan.klein
3.7 years ago by
susan.klein50
Oceania
susan.klein50 wrote:

Hi, was this ever solved? I'm getting same error on a protein search:

blastp -remote -query 1.faa -db nr -out out.blast -outfmt '6 qseqid sseqid pident length slen qstart qend sstart send evalue bitscore stitle' -evalue 1e-10 -max_hsps 1
BLAST options error: err:tried to set option (130) and value (1), line (537).

 

ADD COMMENTlink written 3.7 years ago by susan.klein50

I think this is actually because it was pointing to an incorrect database.

ADD REPLYlink written 3.7 years ago by susan.klein50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 906 users visited in the last hour