Question: problem with some argument in cutadapt
gravatar for F
3.7 years ago by
F3.4k wrote:

hi friends,

why when i use -m 5 or -q 35 or both in cutadapt i get error but without them its ok????

[izadi@lbox161 ~]$ bash
[izadi@lbox161 ~]$ cd /usr/data/nfs6/izadi/microarray/ssr/sratoolkit.2.5.2-centos_linux64/bin/
[izadi@lbox161 bin]$ export CUT=/usr/data/nfs6/izadi/microarray/ssr/cutadapt-1.8.3/bin/
[izadi@lbox161 bin]$ echo $CUT
[izadi@lbox161 bin]$ $CUT/cutadapt -a -m 5 -q 35 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
cutadapt version 1.8.3
Copyright (C) 2010-2015 Marcel Martin <>

cutadapt removes adapter sequences from high-throughput sequencing reads.

    cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq

For paired-end reads:
    cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq

Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. The reverse complement is *not* automatically
searched. All reads from input.fastq will be written to output.fastq with the
adapter sequence removed. Adapter matching is error-tolerant. Multiple adapter
sequences can be given (use further -a options), but only the best-matching
adapter will be removed.

Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.

Some other available features are:
  * Various other adapter types (5' adapters, "mixed" 5'/3' adapters etc.)
  * Trimming a fixed number of bases
  * Quality trimming
  * Trimming colorspace reads
  * Filtering reads by various criteria

Use "cutadapt --help" to see all command-line options.
See for full documentation.

cutadapt: error: Too many parameters.
[izadi@lbox161 bin]$ $CUT/cutadapt -a -m 5 -q 36 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
cutadapt version 1.8.3
Copyright (C) 2010-2015 Marcel Martin <>

cutadapt removes adapter sequences from high-throughput sequencing reads.

    cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq

For paired-end reads:
    cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq

Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. The reverse complement is *not* automatically
searched. All reads from input.fastq will be written to output.fastq with the
adapter sequence removed. Adapter matching is error-tolerant. Multiple adapter
sequences can be given (use further -a options), but only the best-matching
adapter will be removed.

Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.

Some other available features are:
  * Various other adapter types (5' adapters, "mixed" 5'/3' adapters etc.)
  * Trimming a fixed number of bases
  * Quality trimming
  * Trimming colorspace reads
  * Filtering reads by various criteria

Use "cutadapt --help" to see all command-line options.
See for full documentation.

cutadapt: error: Too many parameters.
[izadi@lbox161 bin]$ $CUT/cutadapt -a -m 5 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
cutadapt version 1.8.3
Copyright (C) 2010-2015 Marcel Martin <>

cutadapt removes adapter sequences from high-throughput sequencing reads.

    cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq

For paired-end reads:
    cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq

Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. The reverse complement is *not* automatically
searched. All reads from input.fastq will be written to output.fastq with the
adapter sequence removed. Adapter matching is error-tolerant. Multiple adapter
sequences can be given (use further -a options), but only the best-matching
adapter will be removed.

Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.

Some other available features are:
  * Various other adapter types (5' adapters, "mixed" 5'/3' adapters etc.)
  * Trimming a fixed number of bases
  * Quality trimming
  * Trimming colorspace reads
  * Filtering reads by various criteria

Use "cutadapt --help" to see all command-line options.
See for full documentation.

cutadapt: error: Too many parameters.
[izadi@lbox161 bin]$ $CUT/cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
This is cutadapt 1.8.3 with Python 2.7.10
Command line parameters: -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq
Trimming 1 adapter with at most 10.0% errors in single-end mode ...
[izadi@lbox161 bin]$ 

cutadapt rna-seq myposts adapter • 3.6k views
ADD COMMENTlink modified 3.7 years ago by James Ashmore2.6k • written 3.7 years ago by F3.4k
gravatar for James Ashmore
3.7 years ago by
James Ashmore2.6k
UK/Edinburgh/MRC Centre for Regenerative Medicine
James Ashmore2.6k wrote:

You need to provide the adapter sequence straight after the -a flag, so your original command:

$CUT/cutadapt -a -m 5 -q 35 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq

should be

$CUT/cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -m 5 -q 35 SRR018347.fastq > SRR018347_trimmed.fastq
ADD COMMENTlink written 3.7 years ago by James Ashmore2.6k

thank uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu

you saved me from madness 

ADD REPLYlink written 3.7 years ago by F3.4k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1075 users visited in the last hour