Entering edit mode
10.1 years ago
zizigolu
★
4.4k
Hi friends,
Why when I use -m 5 or -q 35 or both in cutadapt I get error but without them its ok?
[izadi@lbox161 ~]$ bash
[izadi@lbox161 ~]$ cd /usr/data/nfs6/izadi/microarray/ssr/sratoolkit.2.5.2-centos_linux64/bin/
[izadi@lbox161 bin]$ export CUT=/usr/data/nfs6/izadi/microarray/ssr/cutadapt-1.8.3/bin/
[izadi@lbox161 bin]$ echo $CUT
/usr/data/nfs6/izadi/microarray/ssr/cutadapt-1.8.3/bin/
[izadi@lbox161 bin]$ $CUT/cutadapt -a -m 5 -q 35 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
cutadapt version 1.8.3
Copyright (C) 2010-2015 Marcel Martin <marcel.martin@scilifelab.se>
cutadapt removes adapter sequences from high-throughput sequencing reads.
Usage:
cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
For paired-end reads:
cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq
Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. The reverse complement is *not* automatically
searched. All reads from input.fastq will be written to output.fastq with the
adapter sequence removed. Adapter matching is error-tolerant. Multiple adapter
sequences can be given (use further -a options), but only the best-matching
adapter will be removed.
Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.
Some other available features are:
* Various other adapter types (5' adapters, "mixed" 5'/3' adapters etc.)
* Trimming a fixed number of bases
* Quality trimming
* Trimming colorspace reads
* Filtering reads by various criteria
Use "cutadapt --help" to see all command-line options.
See http://cutadapt.readthedocs.org/ for full documentation.
cutadapt: error: Too many parameters.
[izadi@lbox161 bin]$ $CUT/cutadapt -a -m 5 -q 36 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
cutadapt version 1.8.3
Copyright (C) 2010-2015 Marcel Martin <marcel.martin@scilifelab.se>
cutadapt removes adapter sequences from high-throughput sequencing reads.
Usage:
cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
For paired-end reads:
cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq
Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. The reverse complement is *not* automatically
searched. All reads from input.fastq will be written to output.fastq with the
adapter sequence removed. Adapter matching is error-tolerant. Multiple adapter
sequences can be given (use further -a options), but only the best-matching
adapter will be removed.
Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.
Some other available features are:
* Various other adapter types (5' adapters, "mixed" 5'/3' adapters etc.)
* Trimming a fixed number of bases
* Quality trimming
* Trimming colorspace reads
* Filtering reads by various criteria
Use "cutadapt --help" to see all command-line options.
See http://cutadapt.readthedocs.org/ for full documentation.
cutadapt: error: Too many parameters.
[izadi@lbox161 bin]$ $CUT/cutadapt -a -m 5 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
cutadapt version 1.8.3
Copyright (C) 2010-2015 Marcel Martin <marcel.martin@scilifelab.se>
cutadapt removes adapter sequences from high-throughput sequencing reads.
Usage:
cutadapt -a ADAPTER [options] [-o output.fastq] input.fastq
For paired-end reads:
cutadapt -a ADAPT1 -A ADAPT2 [options] -o out1.fastq -p out2.fastq in1.fastq in2.fastq
Replace "ADAPTER" with the actual sequence of your 3' adapter. IUPAC wildcard
characters are supported. The reverse complement is *not* automatically
searched. All reads from input.fastq will be written to output.fastq with the
adapter sequence removed. Adapter matching is error-tolerant. Multiple adapter
sequences can be given (use further -a options), but only the best-matching
adapter will be removed.
Input may also be in FASTA format. Compressed input and output is supported and
auto-detected from the file name (.gz, .xz, .bz2). Use the file name '-' for
standard input/output. Without the -o option, output is sent to standard output.
Some other available features are:
* Various other adapter types (5' adapters, "mixed" 5'/3' adapters etc.)
* Trimming a fixed number of bases
* Quality trimming
* Trimming colorspace reads
* Filtering reads by various criteria
Use "cutadapt --help" to see all command-line options.
See http://cutadapt.readthedocs.org/ for full documentation.
cutadapt: error: Too many parameters.
[izadi@lbox161 bin]$ $CUT/cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq > SRR018347_trimmed.fastq
This is cutadapt 1.8.3 with Python 2.7.10
Command line parameters: -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA SRR018347.fastq
Trimming 1 adapter with at most 10.0% errors in single-end mode ...
^CInterrupted
Thank you
You saved me from madness