Fa list for illumina sequencing adapters
1
1
Entering edit mode
5.9 years ago
Shicheng Guo ★ 8.8k

Hey my colleagues, 

Who has the fa file for all the illumina sequencing adapter sequences. 

Such as: 

>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Adapter_Index 1-64
GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG

Thanks!
sequencing illumina adapter trim • 2.0k views
ADD COMMENT
3
Entering edit mode
5.9 years ago
h.mon 33k

Very extensive documentation here. You will find fasta files with the adapters distributed along several popular software, for example FastQC and BBTools - just download the packages and browse the files.

ADD COMMENT
2
Entering edit mode

Thanks. I have got the list from FastQC:

./FastQC/Configuration/adapter_list.txt
./FastQC/Configuration/contaminant_list.txt
ADD REPLY

Login before adding your answer.

Traffic: 1120 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6