Question: Mirdeep2 Error: FASTA reads file is not in accordance with the fasta format specifications
0
gravatar for Gabe Anderson
4.6 years ago by
Gabe Anderson10 wrote:

Hi All,

I get this error from while running mirdeep2. I have tried two data sets and the same error results. It says:

First line of FASTA reads file is not in accordance with the fasta format specifications
Please make sure your file is in accordance with the fasta format specifications and does not contain whitespace in IDs or sequences

***** Please check if the option you used (options c) designates the correct format of the supplied reads file earthwormShort1.fa *****

I ran a perl code to delete whitespaces. I also tried this same data sets on other tools like sRNAbench and I had no error. Do I need to tweak the fasta file in a particular way for mirdeep2 to work with it?

Thanks!

rna-seq software error • 2.5k views
ADD COMMENTlink modified 5 months ago by zhang.firework0 • written 4.6 years ago by Gabe Anderson10

You should post the first line of the FASTA file.

ADD REPLYlink modified 7 months ago by RamRS28k • written 4.6 years ago by Matt Shirley9.4k

Here is a few line from the fasta file. I believe Mirdeep wants it formatted in a some kind of format...

>cel1_count=3
TGCCTTGTCTGTCCTAAAAATC
>cel2_count=9
GTTAAGTGGGAAACGATGT
>cel3_count=7
CCGACCTTGAAATACCAC
>cel4_count=7
TAGAAATCCACTATGCTTTGG
>cel5_count=5
CGCGGGTGAGCAGCCTGGTAGCTCGTC
>cel6_count=3
TCCTGTTTTGTAATCGGCTGCA
>cel7_count=4
TACCACGTCCAAGGAAGGC
>cel8_count=3
GGCCGCGTGGCCTAATGGATAAGG

Kindly note that the first header line is not indented as shown. I cant tell why this note editor indents it after I hit submit.

ADD REPLYlink modified 7 months ago by RamRS28k • written 4.6 years ago by Gabe Anderson10
0
gravatar for Matt Shirley
4.6 years ago by
Matt Shirley9.4k
Cambridge, MA
Matt Shirley9.4k wrote:

You should look at the file format description in the documentation. It looks like the mapper.pl script expects the FASTA identifiers to contain two underscores which delimit three fields such as:

>PAN_123456_x969696
ATACAATCTACTGTCTTTCCT
ADD COMMENTlink modified 7 months ago by RamRS28k • written 4.6 years ago by Matt Shirley9.4k
1

Thanks for your response, but then, how can we change our .fa files to fit the mirdeep2 description?

ADD REPLYlink written 5 months ago by jomagrax30
0
gravatar for zhang.firework
5 months ago by
zhang.firework0 wrote:

$ dos2unix reads.fa

sovled my problem!

ADD COMMENTlink modified 5 months ago • written 5 months ago by zhang.firework0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 686 users visited in the last hour