Removing recombination/nucleotide sequences, from fasta files
1
1
Entering edit mode
5.7 years ago
natasha ▴ 100

Hi

I have used clonalframeML to find areas of recombination within my isolates, but I am unsure of how to remove these areas of recombination from each of my isolates sequence fasta. Can anyone help?

I can use cutSeq to extract the nucleotide sequences of recombination and am able to save these in separate fasta files. For example the output of cutSeq provides me with;

>>C9-2007 255226..255835
AAGAATGGAATACGCCGCCAATCAACTGATGTTTGATACCGGCTCATCGGTGCTAGACATTGCTAACAAG
TGCGGCTTTAACTC...
>C9-2007 2828176..2839383
CAGGAAATATTAGCGATGATTTTTTCGCAAAAATTAAAAACATCAATTAATCAAAAGGTTAAAAATAAGA
AGAAGACATT...
>C9-2007 2955993..2969778
CCATAGATAACCTATTACCGAA-TAAATTTGCGTTAAAACTGCCGCAACTATGACACTAACCCTAGGCGA
CTTCAAGAC...
>C9-2007 3554396..3559290
TCTTTATACAGTAAAGATGAGCGGGAATATTTTTATCTAACAGGTTATTTTTTGTGATGAGGTGGGAAAA
ATGAGTCGAA...

However how do I remove these sequences from the original fasta sequence? CutSeq only copies and pastes the recombination, but does not remove it.

clonalframeml recombination remove cutSeq • 1.8k views
ADD COMMENT
2
Entering edit mode
5.7 years ago

extract the region from the fasta header to create a BED file and then use: bedtools maskfasta or bedtools getfasta

ADD COMMENT
1
Entering edit mode

Thank you so much

ADD REPLY

Login before adding your answer.

Traffic: 1979 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6