Question: Removing recombination/nucleotide sequences, from fasta files
1
gravatar for natasha
3.6 years ago by
natasha100
natasha100 wrote:

Hi

I have used clonalframeML to find areas of recombination within my isolates, but I am unsure of how to remove these areas of recombination from each of my isolates sequence fasta. Can anyone help?

I can use cutSeq to extract the nucleotide sequences of recombination and am able to save these in separate fasta files. For example the output of cutSeq provides me with;

>>C9-2007 255226..255835
AAGAATGGAATACGCCGCCAATCAACTGATGTTTGATACCGGCTCATCGGTGCTAGACATTGCTAACAAG
TGCGGCTTTAACTC...
>C9-2007 2828176..2839383
CAGGAAATATTAGCGATGATTTTTTCGCAAAAATTAAAAACATCAATTAATCAAAAGGTTAAAAATAAGA
AGAAGACATT...
>C9-2007 2955993..2969778
CCATAGATAACCTATTACCGAA-TAAATTTGCGTTAAAACTGCCGCAACTATGACACTAACCCTAGGCGA
CTTCAAGAC...
>C9-2007 3554396..3559290
TCTTTATACAGTAAAGATGAGCGGGAATATTTTTATCTAACAGGTTATTTTTTGTGATGAGGTGGGAAAA
ATGAGTCGAA...

However how do I remove these sequences from the original fasta sequence? CutSeq only copies and pastes the recombination, but does not remove it.

ADD COMMENTlink modified 3.6 years ago by Pierre Lindenbaum122k • written 3.6 years ago by natasha100
2
gravatar for Pierre Lindenbaum
3.6 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum122k wrote:

extract the region from the fasta header to create a BED file and then use: bedtools maskfasta  http://bedtools.readthedocs.org/en/latest/content/tools/maskfasta.html or bedtools getfasta http://bedtools.readthedocs.org/en/latest/content/tools/getfasta.html

ADD COMMENTlink written 3.6 years ago by Pierre Lindenbaum122k
1

Thank you so much

ADD REPLYlink written 3.6 years ago by natasha100
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1266 users visited in the last hour